RchiOBHm_Chr1g0361031

DNA-directed primase polymerase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001804
Physical Location & Seq
Reverse (-)
53024679 .. 53025059
381 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 306 bp
ATGCAGGTCAACCCTAGTTTTGGAAAATCTTACAGTTGGCCCCAAGAATTTGCATTGAATGGTTGCACCAATGATGCTTCAGCAACATACTTCCTGGGGAAATCTCCATTTCCAGCTTTGGATGCATTTGTAGAATTTGTTGCTACATTTGGAAATGTCTCAGGTAAAATTCGCAGCTGGTATTGGTTCTCAGAGTTTGGACTTATGGTCTACAGCATGTCAAGAAACAGATACTGTGAGCGAATTGGCAGACAGCACAAAAGCAATCATGGTAAAGCCTATACATTGTATCTTATGCAATCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Herpes_UL52

Protein Analysis

101

Amino Acids

11.61

Weight (kDa)

9.23

Isoelectric Point (pI)

37.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 210
AcsI RAATTY 3 cut(s) 47, 134, 168
AcuI CTGAAG 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 1 cut(s) 58
AhdI GACNNNNNGTC 1 cut(s) 206
AjnI CCWGG 1 cut(s) 93
AluBI AGCT 2 cut(s) 116, 177
AluI AGCT 2 cut(s) 116, 177
Alw26I GTCTC 1 cut(s) 163
AlwNI CAGNNNCTG 1 cut(s) 234
AoxI GGCC 1 cut(s) 38
ApeKI GCWGC 1 cut(s) 174
ApoI RAATTY 3 cut(s) 47, 134, 168
AspS9I GGNCC 1 cut(s) 39
BbvI GCAGC 1 cut(s) 186
BciT130I CCWGG 1 cut(s) 95
BcoDI GTCTC 1 cut(s) 163
BfaI CTAG 1 cut(s) 15
BfmI CTRYAG 1 cut(s) 211
BisI GCNGC 1 cut(s) 175
BlsI GCNGC 1 cut(s) 176
Bme1390I CCNGG 1 cut(s) 95
BmeRI GACNNNNNGTC 1 cut(s) 206
BmgT120I GGNCC 1 cut(s) 39
BmiI GGNNCC 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 95
BmsI GCATC 2 cut(s) 64, 112
BsaJI CCNNGG 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 20
BseBI CCWGG 1 cut(s) 95
BseDI CCNNGG 1 cut(s) 94
BseGI GGATG 1 cut(s) 127
BseLI CCNNNNNNNGG 1 cut(s) 20
BseMII CTCAG 2 cut(s) 174, 204
BseXI GCAGC 1 cut(s) 186
BshFI GGCC 1 cut(s) 40
BslI CCNNNNNNNGG 1 cut(s) 20
BsmAI GTCTC 1 cut(s) 163
BsnI GGCC 1 cut(s) 40
BspANI GGCC 1 cut(s) 40
BspCNI CTCAG 2 cut(s) 173, 203
BspHI TCATGA 1 cut(s) 302
BspLI GGNNCC 1 cut(s) 41
BssECI CCNNGG 1 cut(s) 94
Bst2UI CCWGG 1 cut(s) 95
Bst4CI ACNGT 2 cut(s) 35, 236
BstDEI CTNAG 2 cut(s) 160, 190
BstF5I GGATG 1 cut(s) 127
BstMAI GTCTC 1 cut(s) 163
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstNI CCWGG 1 cut(s) 95
BstNSI RCATGY 1 cut(s) 220
BstSCI CCNGG 1 cut(s) 93
BstSFI CTRYAG 1 cut(s) 211
BstV1I GCAGC 1 cut(s) 186
BsuRI GGCC 1 cut(s) 40
BtsCI GGATG 1 cut(s) 127
CaiI CAGNNNCTG 1 cut(s) 234
CciI TCATGA 1 cut(s) 302
Cfr13I GGNCC 1 cut(s) 39
CviAII CATG 3 cut(s) 217, 269, 303
CviJI RGCY 4 cut(s) 40, 116, 177, 278
CviKI_1 RGCY 4 cut(s) 40, 116, 177, 278
DdeI CTNAG 2 cut(s) 160, 190
DriI GACNNNNNGTC 1 cut(s) 206
Eam1105I GACNNNNNGTC 1 cut(s) 206
Eco57I CTGAAG 1 cut(s) 63
EcoRII CCWGG 1 cut(s) 93
EcoT22I ATGCAT 1 cut(s) 127
FaeI CATG 3 cut(s) 220, 272, 306
FaiI YATR 7 cut(s) 88, 206, 218, 270, 282, 296, 304
FatI CATG 3 cut(s) 216, 268, 302
FblI GTMKAC 1 cut(s) 210
Fnu4HI GCNGC 1 cut(s) 175
FokI GGATG 1 cut(s) 134
Fsp4HI GCNGC 1 cut(s) 175
FspBI CTAG 1 cut(s) 15
GluI GCNGC 1 cut(s) 175
HaeIII GGCC 1 cut(s) 40
Hin1II CATG 3 cut(s) 220, 272, 306
HincII GTYRAC 1 cut(s) 10
HindII GTYRAC 1 cut(s) 10
Hpy166II GTNNAC 2 cut(s) 10, 211
Hpy188I TCNGA 1 cut(s) 193
Hpy188III TCNNGA 2 cut(s) 222, 303
Hpy8I GTNNAC 2 cut(s) 10, 211
HpyCH4III ACNGT 2 cut(s) 35, 236
HpyCH4V TGCA 5 cut(s) 4, 53, 66, 125, 298
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpyF3I CTNAG 2 cut(s) 160, 190
Hsp92II CATG 3 cut(s) 220, 272, 306
LpnPI CCDG 5 cut(s) 80, 107, 126, 147, 163
Lsp1109I GCAGC 1 cut(s) 186
LweI GCATC 2 cut(s) 64, 112
MaeI CTAG 1 cut(s) 15
MluCI AATT 4 cut(s) 47, 134, 168, 243
Mph1103I ATGCAT 1 cut(s) 127
MspA1I CMGCKG 1 cut(s) 177
MspR9I CCNGG 1 cut(s) 95
MvaI CCWGG 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 122
NlaIII CATG 3 cut(s) 220, 272, 306
NlaIV GGNNCC 1 cut(s) 41
NsiI ATGCAT 1 cut(s) 127
NspI RCATGY 1 cut(s) 220
PagI TCATGA 1 cut(s) 302
PkrI GCNGC 1 cut(s) 176
Psp6I CCWGG 1 cut(s) 93
PspGI CCWGG 1 cut(s) 93
PspN4I GGNNCC 1 cut(s) 41
PspPI GGNCC 1 cut(s) 39
PstNI CAGNNNCTG 1 cut(s) 234
PvuII CAGCTG 1 cut(s) 177
SatI GCNGC 1 cut(s) 175
Sau96I GGNCC 1 cut(s) 39
ScrFI CCNGG 1 cut(s) 95
SetI ASST 4 cut(s) 9, 118, 166, 179
SfaNI GCATC 2 cut(s) 64, 112
SfcI CTRYAG 1 cut(s) 211
Sse9I AATT 4 cut(s) 47, 134, 168, 243
SspMI CTAG 1 cut(s) 15
StyD4I CCNGG 1 cut(s) 93
TaaI ACNGT 2 cut(s) 35, 236
TasI AATT 4 cut(s) 47, 134, 168, 243
TseI GCWGC 1 cut(s) 174
XapI RAATTY 3 cut(s) 47, 134, 168
XceI RCATGY 1 cut(s) 220
XmiI GTMKAC 1 cut(s) 210
XspI CTAG 1 cut(s) 15
Zsp2I ATGCAT 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.