RchiOBHm_Chr3g0471831

Signal peptidase, peptidase S26

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0003483
Physical Location & Seq
Forward (+)
17679420 .. 17680152
733 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43757

Sequence Viewer

Length: 306 bp
ATGGCATTCCCTGGCTGTTGTTACCCTTTTCTAGGTCGTTTTTCTTCGTCTTCGAGACTGCACTATACCAAAATCTTCACCTTCGTATTTCAATTTGCTCTTATGGCGATCCGCATCTCCCTAGGATTTTCCGGCTTCGTGGCCCATAACCTAGCCTCCTCTGCCAATATTCACGTCAATAATTGCTGTGGCATCCACAGGTGCTGGGTCAGGTCTCTGCTATTCGGCACTAACCAGATTAGTGTCTTGGATGTGGGGTTCAATGTGGTTTTTAGCGACTTAAAGGCCCAGATTTGTGAAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S26

Protein Analysis

101

Amino Acids

11.23

Weight (kDa)

8.92

Isoelectric Point (pI)

40.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 112
AclWI GGATC 1 cut(s) 103
AfiI CCNNNNNNNGG 1 cut(s) 32
AgsI TTSAA 2 cut(s) 92, 262
AjiI CACGTC 1 cut(s) 175
AjnI CCWGG 1 cut(s) 10
AloI GAACNNNNNNTCC 2 cut(s) 242, 274
Alw26I GTCTC 2 cut(s) 49, 219
AlwI GGATC 1 cut(s) 103
AlwNI CAGNNNCTG 1 cut(s) 204
AoxI GGCC 2 cut(s) 141, 285
AspA2I CCTAGG 1 cut(s) 121
AspS9I GGNCC 2 cut(s) 142, 286
AsuHPI GGTGA 1 cut(s) 70
AvrII CCTAGG 1 cut(s) 121
BbsI GAAGAC 1 cut(s) 42
BciT130I CCWGG 1 cut(s) 12
BcoDI GTCTC 2 cut(s) 49, 219
BfaI CTAG 3 cut(s) 32, 122, 152
BlnI CCTAGG 1 cut(s) 121
Bme1390I CCNGG 1 cut(s) 12
BmgBI CACGTC 1 cut(s) 175
BmgT120I GGNCC 2 cut(s) 142, 286
BmrFI CCNGG 1 cut(s) 12
BmsI GCATC 2 cut(s) 123, 201
BpiI GAAGAC 1 cut(s) 42
BsaBI GATNNNNATC 1 cut(s) 113
BsaI GGTCTC 1 cut(s) 219
BsaJI CCNNGG 2 cut(s) 10, 121
BsaXI ACNNNNNCTCC 2 cut(s) 140, 170
Bsc4I CCNNNNNNNGG 1 cut(s) 32
Bse8I GATNNNNATC 1 cut(s) 113
BseBI CCWGG 1 cut(s) 12
BseDI CCNNGG 2 cut(s) 10, 121
BseGI GGATG 2 cut(s) 192, 256
BseJI GATNNNNATC 1 cut(s) 113
BseLI CCNNNNNNNGG 1 cut(s) 32
BseRI GAGGAG 1 cut(s) 148
BseYI CCCAGC 1 cut(s) 204
BsgI GTGCAG 1 cut(s) 44
BshFI GGCC 2 cut(s) 143, 287
BsiSI CCGG 1 cut(s) 132
BslI CCNNNNNNNGG 1 cut(s) 32
BsmAI GTCTC 2 cut(s) 49, 219
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 2 cut(s) 143, 287
Bso31I GGTCTC 1 cut(s) 219
Bsp143I GATC 1 cut(s) 108
BspACI CCGC 1 cut(s) 112
BspANI GGCC 2 cut(s) 143, 287
BspPI GGATC 1 cut(s) 103
BspTNI GGTCTC 1 cut(s) 219
BssECI CCNNGG 2 cut(s) 10, 121
BssMI GATC 1 cut(s) 108
BssT1I CCWWGG 1 cut(s) 121
Bst2UI CCWGG 1 cut(s) 12
BstENI CCTNNNNNAGG 1 cut(s) 30
BstF5I GGATG 2 cut(s) 192, 256
BstKTI GATC 1 cut(s) 111
BstMAI GTCTC 2 cut(s) 49, 219
BstMBI GATC 1 cut(s) 108
BstMWI GCNNNNNNNGC 2 cut(s) 104, 161
BstNI CCWGG 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 10
BstV2I GAAGAC 1 cut(s) 42
BsuRI GGCC 2 cut(s) 143, 287
BtrI CACGTC 1 cut(s) 175
BtsCI GGATG 2 cut(s) 192, 256
CaiI CAGNNNCTG 1 cut(s) 204
Cfr13I GGNCC 2 cut(s) 142, 286
CviJI RGCY 5 cut(s) 15, 135, 143, 155, 287
CviKI_1 RGCY 5 cut(s) 15, 135, 143, 155, 287
DpnI GATC 1 cut(s) 110
DpnII GATC 1 cut(s) 108
Eco130I CCWWGG 1 cut(s) 121
Eco31I GGTCTC 1 cut(s) 219
EcoNI CCTNNNNNAGG 1 cut(s) 30
EcoRII CCWGG 1 cut(s) 10
EcoT14I CCWWGG 1 cut(s) 121
ErhI CCWWGG 1 cut(s) 121
FaiI YATR 3 cut(s) 66, 104, 147
FokI GGATG 2 cut(s) 179, 263
FspBI CTAG 3 cut(s) 32, 122, 152
GsaI CCCAGC 1 cut(s) 208
HaeIII GGCC 2 cut(s) 143, 287
HapII CCGG 1 cut(s) 132
HpaII CCGG 1 cut(s) 132
HphI GGTGA 1 cut(s) 70
Hpy188III TCNNGA 1 cut(s) 54
HpyAV CCTTC 1 cut(s) 91
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 1 cut(s) 61
HpyF10VI GCNNNNNNNGC 2 cut(s) 104, 161
HpySE526I ACGT 1 cut(s) 174
Kzo9I GATC 1 cut(s) 108
LpnPI CCDG 7 cut(s) 24, 145, 184, 190, 196, 248, 302
LweI GCATC 2 cut(s) 123, 201
MaeI CTAG 3 cut(s) 32, 122, 152
MaeII ACGT 1 cut(s) 174
MaeIII GTNAC 1 cut(s) 20
MalI GATC 1 cut(s) 110
MboI GATC 1 cut(s) 108
MboII GAAGA 3 cut(s) 36, 42, 67
MluCI AATT 2 cut(s) 92, 181
MnlI CCTC 2 cut(s) 166, 169
MseI TTAA 1 cut(s) 281
MspI CCGG 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 12
Mva1269I GAATGC 1 cut(s) 5
MvaI CCWGG 1 cut(s) 12
MwoI GCNNNNNNNGC 2 cut(s) 104, 161
NdeII GATC 1 cut(s) 108
PctI GAATGC 1 cut(s) 5
Psp6I CCWGG 1 cut(s) 10
PspFI CCCAGC 1 cut(s) 204
PspGI CCWGG 1 cut(s) 10
PspPI GGNCC 2 cut(s) 142, 286
PstNI CAGNNNCTG 1 cut(s) 204
SaqAI TTAA 1 cut(s) 281
Sau3AI GATC 1 cut(s) 108
Sau96I GGNCC 2 cut(s) 142, 286
ScrFI CCNGG 1 cut(s) 12
SetI ASST 6 cut(s) 37, 83, 153, 177, 203, 215
SfaNI GCATC 2 cut(s) 123, 201
Sse9I AATT 2 cut(s) 92, 181
SsiI CCGC 1 cut(s) 112
SspI AATATT 1 cut(s) 169
SspMI CTAG 3 cut(s) 32, 122, 152
StyD4I CCNGG 1 cut(s) 10
StyI CCWWGG 1 cut(s) 121
TaiI ACGT 1 cut(s) 177
TaqI TCGA 1 cut(s) 53
TasI AATT 2 cut(s) 92, 181
Tru1I TTAA 1 cut(s) 281
Tru9I TTAA 1 cut(s) 281
XagI CCTNNNNNAGG 1 cut(s) 30
XmaJI CCTAGG 1 cut(s) 121
XspI CTAG 3 cut(s) 32, 122, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.