Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000322.1

Orthogroup ID

OG0003483

Physical Location & Seq

Genomic Coordinates Reverse (-)

173534 .. 179174

Gene Structure 5641 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000322.1_g000042.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1341 bp

atggagatccgcatctccctaggattttccggcttcgtggcccataacctagcctcctctgccaatattcacgtcaataattgctgtggcatccacaggtgctgggttaggtctctgctattcggcactaaccaggcggtagcaacaattgacggggaaataggtccacagctttcagtaagaagaaagagagaaggtgttggtgcaacctattttgatgcaaacatgtatccacaaggttctatgggggttgtgccagaagctctccgccctaaacctggtcatttgtccctttctcagcaacgagtttatgaggtaagatgctaccttttacttgggagatcttctcctttgaagaatgccttgtgtactggtctcactagcacatatggttcagcatccggacaacttaacacgggctactcaccaggacctggaagcaaatttgaagatgtttctcgtccattagatgaagcgatggaatccaattctgccctccatcttagtgcttcatctattcatgttggggcggctgatggtgtttcccagcatagttctgaaaatgattctgttgttgcctcatttccttctgctgtttctgcccctgagctgcactctgtagagtcatctgatgctgtaaaggaatctggagtgtcctcacagccaccaccttcacctgctgtaactgaacgtcttggaagtctctcagaaccttccctcaccacaggggctgcattggaaaaataccagattgttgcacagaaggtcaacctttttagcttttacttatctgatgtttgtctagtcctatttgtattggggatgggttcttggtctatttataaaggttcgagaagtgttgtgtttgagaagcattctattgagaggtaccagagagaccagcggctatacaataaccaattggaggaaaccactctatgctctctccttcctgattgtgatgctgattctgatttcacaaggcaaaatgacattgcattgcagctaccagagctgagaaagctgcttcaggtgttgagagaggagagagagggaaggagggtgtggctgtatgataggttggtgtccaatgatgtgttggattttgttgcctctgatgctcgacctgtctatgtgggcaagactgctgggtaccatagcagaacccaggaggagatacatgaattgctactgagttttgctgaagctggagctactgttgtcagactaaaaggaggggatccattggtgtttagaaggggtggagaggagacggattttttgcaacagcaaggaattcaagtgcaagttattccaggtacaataatgactcagtactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03018 map03018

Pfam Domains

Protein Families

CNOT1_CAF1_bind CNOT1_HEAT CNOT1_TTP_bind DUF3819 Not1

Protein Analysis

446

Amino Acids

48.71

Weight (kDa)

5.71

Isoelectric Point (pI)

47.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003483)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0344821 RchiOBHm_Chr1g0344831 RchiOBHm_Chr3g0471831 RchiOBHm_Chr5g0080341 RchiOBHm_Chr7g0235701
rosa_multiflora	Rmu_sc0000079.1_g000003 Rmu_sc0000322.1_g000042 Rmu_sc0001266.1_g000018 Rmu_sc0003941.1_g000012 Rmu_sc0004465.1_g000027 Rmu_sc0005738.1_g000015 Rmu_sc0016401.1_g000001 Rmu_sc0018213.1_g000001
rosa_roxburghii	Rroxscaffold_3G00233470 Rroxscaffold_3G00234220
rosa_samantha	Rh2BG430200 Rh2CG546400 Rh2DG440200 Rh3CG281000 Rh3CG281100 Rh3CG367000 Rh3DG277100 Rh3DG297300 Rh3DG342900 Rh3DG365000 Rh4AG049800 Rh4CG237300 Rh4CG237800 Rh4DG160500 Rh5CG565500 Rh5DG412600 Rh6BG298900 Rh7DG372800 Rh7DG372900
rosa_wichuraiana	Rw3G022420 Rw4G018200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	843
AarI	CACCTGC	1 cut(s)	685
Acc36I	ACCTGC	1 cut(s)	685
Acc65I	GGTACC	2 cut(s)	888, 1152
AccB1I	GGYRCC	2 cut(s)	888, 1152
AccB7I	CCANNNNNTGG	1 cut(s)	434
AccIII	TCCGGA	1 cut(s)	401
AciI	CCGC	5 cut(s)	10, 137, 268, 530, 904
AclWI	GGATC	2 cut(s)	1235, 1248
AcsI	RAATTY	2 cut(s)	443, 1296
AcuI	CTGAAG	2 cut(s)	1013, 1224
AfaI	GTAC	5 cut(s)	370, 890, 1154, 1321, 1337
AfiI	CCNNNNNNNGG	3 cut(s)	278, 434, 925
AflIII	ACRYGT	1 cut(s)	225
AgsI	TTSAA	3 cut(s)	355, 449, 1301
AjiI	CACGTC	1 cut(s)	73
AjnI	CCWGG	6 cut(s)	132, 277, 427, 433, 1167, 1315
AluBI	AGCT	9 cut(s)	172, 263, 610, 780, 1006, 1015, 1024, 1208, 1214
AluI	AGCT	9 cut(s)	172, 263, 610, 780, 1006, 1015, 1024, 1208, 1214
Alw26I	GTCTC	5 cut(s)	117, 380, 707, 891, 1265
AlwI	GGATC	2 cut(s)	1235, 1248
AlwNI	CAGNNNCTG	3 cut(s)	102, 434, 731
Aor13HI	TCCGGA	1 cut(s)	401
AoxI	GGCC	1 cut(s)	39
ApeKI	GCWGC	4 cut(s)	610, 731, 1003, 1024
ApoI	RAATTY	2 cut(s)	443, 1296
ArsI	GACNNNNNNTTYG	2 cut(s)	1264, 1296
Asp718I	GGTACC	2 cut(s)	888, 1152
AspA2I	CCTAGG	1 cut(s)	19
AspS9I	GGNCC	3 cut(s)	40, 164, 431
AsuHPI	GGTGA	3 cut(s)	417, 666, 712
AvaII	GGWCC	2 cut(s)	164, 431
AvrII	CCTAGG	1 cut(s)	19
BamHI	GGATCC	1 cut(s)	1240
BanI	GGYRCC	2 cut(s)	888, 1152
BbvI	GCAGC	4 cut(s)	597, 718, 1011, 1015
BccI	CCATC	4 cut(s)	472, 507, 530, 817
BciT130I	CCWGG	6 cut(s)	134, 279, 429, 435, 1169, 1317
BciVI	GTATCC	1 cut(s)	240
BcoDI	GTCTC	5 cut(s)	117, 380, 707, 891, 1265
BfaI	CTAG	5 cut(s)	20, 50, 381, 803, 1339
BfmI	CTRYAG	1 cut(s)	618
BfuAI	ACCTGC	1 cut(s)	685
BfuI	GTATCC	1 cut(s)	240
BglII	AGATCT	1 cut(s)	341
BisI	GCNGC	6 cut(s)	531, 611, 732, 905, 1004, 1025
BlnI	CCTAGG	1 cut(s)	19
BlsI	GCNGC	6 cut(s)	532, 612, 733, 906, 1005, 1026
BmcAI	AGTACT	1 cut(s)	1337
Bme1390I	CCNGG	6 cut(s)	134, 279, 429, 435, 1169, 1317
Bme18I	GGWCC	2 cut(s)	164, 431
BmgBI	CACGTC	1 cut(s)	73
BmgT120I	GGNCC	3 cut(s)	40, 164, 431
BmiI	GGNNCC	3 cut(s)	890, 1154, 1242
BmrFI	CCNGG	6 cut(s)	134, 279, 429, 435, 1169, 1317
BmsI	GCATC	8 cut(s)	21, 99, 208, 311, 407, 622, 952, 1108
BplI	GAGNNNNNCTC	4 cut(s)	331, 363, 599, 631
BpmI	CTGGAG	2 cut(s)	669, 1230
Bpu10I	CCTNAGC	1 cut(s)	606
BsaBI	GATNNNNATC	1 cut(s)	11
BsaI	GGTCTC	3 cut(s)	117, 380, 891
BsaJI	CCNNGG	2 cut(s)	19, 1167
BsaWI	WCCGGW	1 cut(s)	401
BsaXI	ACNNNNNCTCC	4 cut(s)	38, 68, 1203, 1233
Bsc4I	CCNNNNNNNGG	3 cut(s)	278, 434, 925
Bse1I	ACTGG	1 cut(s)	376
Bse3DI	GCAATG	2 cut(s)	993, 998
Bse8I	GATNNNNATC	1 cut(s)	11
BseAI	TCCGGA	1 cut(s)	401
BseBI	CCWGG	6 cut(s)	134, 279, 429, 435, 1169, 1317
BseDI	CCNNGG	2 cut(s)	19, 1167
BseGI	GGATG	3 cut(s)	90, 398, 828
BseJI	GATNNNNATC	1 cut(s)	11
BseLI	CCNNNNNNNGG	3 cut(s)	278, 434, 925
BseMI	GCAATG	2 cut(s)	993, 998
BseMII	CTCAG	5 cut(s)	311, 597, 720, 1007, 1184
BseNI	ACTGG	1 cut(s)	376
BseRI	GAGGAG	4 cut(s)	46, 1058, 1187, 1283
BseXI	GCAGC	4 cut(s)	597, 718, 1011, 1015
BseYI	CCCAGC	3 cut(s)	102, 546, 1148
BsgI	GTGCAG	1 cut(s)	596
BshFI	GGCC	1 cut(s)	41
BshNI	GGYRCC	2 cut(s)	888, 1152
BsiSI	CCGG	2 cut(s)	30, 402
BslFI	GGGAC	1 cut(s)	274
BslI	CCNNNNNNNGG	3 cut(s)	278, 434, 925
BsmAI	GTCTC	5 cut(s)	117, 380, 707, 891, 1265
BsmBI	CGTCTC	1 cut(s)	1265
BsmFI	GGGAC	1 cut(s)	274
BsmI	GAATGC	2 cut(s)	364, 874
BsnI	GGCC	1 cut(s)	41
Bso31I	GGTCTC	3 cut(s)	117, 380, 891
Bsp13I	TCCGGA	1 cut(s)	401
Bsp143I	GATC	3 cut(s)	6, 341, 1240
BspACI	CCGC	5 cut(s)	10, 137, 268, 530, 904
BspANI	GGCC	1 cut(s)	41
BspCNI	CTCAG	5 cut(s)	310, 598, 719, 1008, 1185
BspEI	TCCGGA	1 cut(s)	401
BspLI	GGNNCC	3 cut(s)	890, 1154, 1242
BspMI	ACCTGC	1 cut(s)	685
BspPI	GGATC	2 cut(s)	1235, 1248
BspT107I	GGYRCC	2 cut(s)	888, 1152
BspTNI	GGTCTC	3 cut(s)	117, 380, 891
BsrDI	GCAATG	2 cut(s)	993, 998
BsrI	ACTGG	1 cut(s)	376
BssECI	CCNNGG	2 cut(s)	19, 1167
BssMI	GATC	3 cut(s)	6, 341, 1240
BssT1I	CCWWGG	1 cut(s)	19
Bst2UI	CCWGG	6 cut(s)	134, 279, 429, 435, 1169, 1317
Bst4CI	ACNGT	1 cut(s)	1219
BstDEI	CTNAG	7 cut(s)	297, 503, 606, 706, 1016, 1193, 1332
BstF5I	GGATG	3 cut(s)	90, 398, 828
BstKTI	GATC	3 cut(s)	9, 344, 1243
BstMAI	GTCTC	5 cut(s)	117, 380, 707, 891, 1265
BstMBI	GATC	3 cut(s)	6, 341, 1240
BstMWI	GCNNNNNNNGC	5 cut(s)	59, 599, 1012, 1021, 1118
BstNI	CCWGG	6 cut(s)	134, 279, 429, 435, 1169, 1317
BstNSI	RCATGY	1 cut(s)	229
BstSCI	CCNGG	6 cut(s)	132, 277, 427, 433, 1167, 1315
BstSFI	CTRYAG	1 cut(s)	618
BstV1I	GCAGC	4 cut(s)	597, 718, 1011, 1015
BstX2I	RGATCY	3 cut(s)	6, 341, 1240
BstYI	RGATCY	3 cut(s)	6, 341, 1240
BsuI	GTATCC	1 cut(s)	240
BsuRI	GGCC	1 cut(s)	41
BtgZI	GCGATG	1 cut(s)	491
BtrI	CACGTC	1 cut(s)	73
BtsCI	GGATG	3 cut(s)	90, 398, 828
BveI	ACCTGC	1 cut(s)	685
CaiI	CAGNNNCTG	3 cut(s)	102, 434, 731
Cfr13I	GGNCC	3 cut(s)	40, 164, 431
CsiI	ACCWGGT	1 cut(s)	277
Csp6I	GTAC	5 cut(s)	369, 889, 1153, 1320, 1336
CviAII	CATG	3 cut(s)	226, 521, 1181
CviQI	GTAC	5 cut(s)	369, 889, 1153, 1320, 1336
DdeI	CTNAG	7 cut(s)	297, 503, 606, 706, 1016, 1193, 1332
DpnI	GATC	3 cut(s)	8, 343, 1242
DpnII	GATC	3 cut(s)	6, 341, 1240
EciI	GGCGGA	1 cut(s)	257
Eco130I	CCWWGG	1 cut(s)	19
Eco31I	GGTCTC	3 cut(s)	117, 380, 891
Eco47I	GGWCC	2 cut(s)	164, 431
Eco57I	CTGAAG	2 cut(s)	1013, 1224
EcoO109I	RGGNCCY	1 cut(s)	431
EcoRI	GAATTC	1 cut(s)	1296
EcoRII	CCWGG	6 cut(s)	132, 277, 427, 433, 1167, 1315
EcoT14I	CCWWGG	1 cut(s)	19
ErhI	CCWWGG	1 cut(s)	19
Esp3I	CGTCTC	1 cut(s)	1265
FaeI	CATG	3 cut(s)	229, 524, 1184
FalI	AAGNNNNNCTT	2 cut(s)	347, 379
FaqI	GGGAC	1 cut(s)	274
FatI	CATG	3 cut(s)	225, 520, 1180
FauNDI	CATATG	1 cut(s)	388
Fnu4HI	GCNGC	6 cut(s)	531, 611, 732, 905, 1004, 1025
FokI	GGATG	3 cut(s)	77, 385, 835
Fsp4HI	GCNGC	6 cut(s)	531, 611, 732, 905, 1004, 1025
FspBI	CTAG	5 cut(s)	20, 50, 381, 803, 1339
GluI	GCNGC	6 cut(s)	531, 611, 732, 905, 1004, 1025
GsaI	CCCAGC	3 cut(s)	106, 550, 1152
GsuI	CTGGAG	2 cut(s)	669, 1230
HaeIII	GGCC	1 cut(s)	41
HapII	CCGG	2 cut(s)	30, 402
Hin1II	CATG	3 cut(s)	229, 524, 1184
HincII	GTYRAC	1 cut(s)	769
HindII	GTYRAC	1 cut(s)	769
HinfI	GANTC	6 cut(s)	482, 566, 623, 644, 968, 1330
HpaII	CCGG	2 cut(s)	30, 402
HphI	GGTGA	3 cut(s)	417, 666, 712
Hpy166II	GTNNAC	3 cut(s)	167, 369, 769
Hpy188I	TCNGA	7 cut(s)	559, 631, 709, 793, 973, 1117, 1226
Hpy188III	TCNNGA	4 cut(s)	402, 648, 852, 953
Hpy8I	GTNNAC	3 cut(s)	167, 369, 769
HpyAV	CCTTC	8 cut(s)	188, 597, 681, 723, 757, 959, 1050, 1251
HpyCH4III	ACNGT	1 cut(s)	1219
HpyCH4IV	ACGT	2 cut(s)	72, 691
HpyCH4V	TGCA	9 cut(s)	206, 221, 613, 734, 758, 998, 1003, 1285, 1306
HpyF10VI	GCNNNNNNNGC	5 cut(s)	59, 599, 1012, 1021, 1118
HpyF3I	CTNAG	7 cut(s)	297, 503, 606, 706, 1016, 1193, 1332
HpySE526I	ACGT	2 cut(s)	72, 691
Hsp92II	CATG	3 cut(s)	229, 524, 1184
Kpn2I	TCCGGA	1 cut(s)	401
KpnI	GGTACC	2 cut(s)	892, 1156
Kzo9I	GATC	3 cut(s)	6, 341, 1240
LmnI	GCTCC	1 cut(s)	1211
Lsp1109I	GCAGC	4 cut(s)	597, 718, 1011, 1015
LweI	GCATC	8 cut(s)	21, 99, 208, 311, 407, 622, 952, 1108
MabI	ACCWGGT	1 cut(s)	277
MaeI	CTAG	5 cut(s)	20, 50, 381, 803, 1339
MaeII	ACGT	2 cut(s)	72, 691
MaeIII	GTNAC	1 cut(s)	682
MalI	GATC	3 cut(s)	8, 343, 1242
MboI	GATC	3 cut(s)	6, 341, 1240
MboII	GAAGA	4 cut(s)	195, 336, 367, 461
MfeI	CAATTG	2 cut(s)	147, 920
MflI	RGATCY	3 cut(s)	6, 341, 1240
MluCI	AATT	7 cut(s)	79, 147, 443, 487, 920, 1184, 1296
MlyI	GAGTC	2 cut(s)	632, 1324
MmeI	TCCRAC	1 cut(s)	1080
MroI	TCCGGA	1 cut(s)	401
MseI	TTAA	1 cut(s)	411
MslI	CAYNNNNRTG	1 cut(s)	504
MspA1I	CMGCKG	1 cut(s)	904
MspI	CCGG	2 cut(s)	30, 402
MspR9I	CCNGG	6 cut(s)	134, 279, 429, 435, 1169, 1317
MunI	CAATTG	2 cut(s)	147, 920
Mva1269I	GAATGC	2 cut(s)	364, 874
MvaI	CCWGG	6 cut(s)	134, 279, 429, 435, 1169, 1317
MwoI	GCNNNNNNNGC	5 cut(s)	59, 599, 1012, 1021, 1118
NdeI	CATATG	1 cut(s)	388
NdeII	GATC	3 cut(s)	6, 341, 1240
NlaIII	CATG	3 cut(s)	229, 524, 1184
NlaIV	GGNNCC	3 cut(s)	890, 1154, 1242
NspI	RCATGY	1 cut(s)	229
PaqCI	CACCTGC	1 cut(s)	685
PciI	ACATGT	1 cut(s)	225
PctI	GAATGC	2 cut(s)	364, 874
PfeI	GAWTC	4 cut(s)	482, 566, 644, 968
PflMI	CCANNNNNTGG	1 cut(s)	434
PkrI	GCNGC	6 cut(s)	532, 612, 733, 906, 1005, 1026
PleI	GAGTC	2 cut(s)	631, 1324
PpsI	GAGTC	2 cut(s)	631, 1324
PpuMI	RGGWCCY	1 cut(s)	431
PscI	ACATGT	1 cut(s)	225
PsiI	TTATAA	1 cut(s)	843
Psp5II	RGGWCCY	1 cut(s)	431
Psp6I	CCWGG	6 cut(s)	132, 277, 427, 433, 1167, 1315
PspFI	CCCAGC	3 cut(s)	102, 546, 1148
PspGI	CCWGG	6 cut(s)	132, 277, 427, 433, 1167, 1315
PspN4I	GGNNCC	3 cut(s)	890, 1154, 1242
PspPI	GGNCC	3 cut(s)	40, 164, 431
PspPPI	RGGWCCY	1 cut(s)	431
PstNI	CAGNNNCTG	3 cut(s)	102, 434, 731
PsuI	RGATCY	3 cut(s)	6, 341, 1240
RsaI	GTAC	5 cut(s)	370, 890, 1154, 1321, 1337
RsaNI	GTAC	5 cut(s)	369, 889, 1153, 1320, 1336
RseI	CAYNNNNRTG	1 cut(s)	504
SaqAI	TTAA	1 cut(s)	411
SatI	GCNGC	6 cut(s)	531, 611, 732, 905, 1004, 1025
Sau3AI	GATC	3 cut(s)	6, 341, 1240
Sau96I	GGNCC	3 cut(s)	40, 164, 431
ScaI	AGTACT	1 cut(s)	1337
SchI	GAGTC	2 cut(s)	632, 1324
ScrFI	CCNGG	6 cut(s)	134, 279, 429, 435, 1169, 1317
SexAI	ACCWGGT	1 cut(s)	277
SfaNI	GCATC	8 cut(s)	21, 99, 208, 311, 407, 622, 952, 1108
SfcI	CTRYAG	1 cut(s)	618
SinI	GGWCC	2 cut(s)	164, 431
SmiMI	CAYNNNNRTG	1 cut(s)	504
Sse9I	AATT	7 cut(s)	79, 147, 443, 487, 920, 1184, 1296
SsiI	CCGC	5 cut(s)	10, 137, 268, 530, 904
SspI	AATATT	1 cut(s)	67
SspMI	CTAG	5 cut(s)	20, 50, 381, 803, 1339
StyD4I	CCNGG	6 cut(s)	132, 277, 427, 433, 1167, 1315
StyI	CCWWGG	1 cut(s)	19
TaaI	ACNGT	1 cut(s)	1219
TaiI	ACGT	2 cut(s)	75, 694
TaqI	TCGA	2 cut(s)	851, 1123
TasI	AATT	7 cut(s)	79, 147, 443, 487, 920, 1184, 1296
TatI	WGTACW	2 cut(s)	368, 1335
TauI	GCSGC	2 cut(s)	533, 907
TfiI	GAWTC	4 cut(s)	482, 566, 644, 968
Tru1I	TTAA	1 cut(s)	411
Tru9I	TTAA	1 cut(s)	411
TseI	GCWGC	4 cut(s)	610, 731, 1003, 1024
TspDTI	ATGAA	4 cut(s)	486, 501, 509, 1197
TspGWI	ACGGA	1 cut(s)	1289
Van91I	CCANNNNNTGG	1 cut(s)	434
VpaK11BI	GGWCC	2 cut(s)	164, 431
XapI	RAATTY	2 cut(s)	443, 1296
XceI	RCATGY	1 cut(s)	229
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1096
XmaJI	CCTAGG	1 cut(s)	19
XspI	CTAG	5 cut(s)	20, 50, 381, 803, 1339
ZrmI	AGTACT	1 cut(s)	1337

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.