RchiOBHm_Chr7g0235701

Belongs to the universal ribosomal protein uL24 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0003483
Physical Location & Seq
Forward (+)
60498636 .. 60502104
3469 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21121

Sequence Viewer

Length: 210 bp
ATGAAGGCGGGATTGATATTTACTATCAAAGCTCCTCTTCATGCCTCAAATGTGCAAGTTGTTGATCCAGTAACAGGGAGACCTTGTAAGTGTGGGGTTAAATATCTTGAGGATGGAACAAAAGTTGAGAGTAGCAAGAGGCACAGGAGCATCAGGATCTATAGCTATGAAAAAAGTGAAGGGCACAAGACCTTGCGATTGCAGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
KOW ribosomal_L24

Protein Analysis

69

Amino Acids

7.76

Weight (kDa)

9.8

Isoelectric Point (pI)

41.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ribosomal_L24 PF17136 3 - 47 2.3e-11 Large ribosomal subunit protein uL24, C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 193
AciI CCGC 1 cut(s) 8
AclWI GGATC 2 cut(s) 59, 164
AfiI CCNNNNNNNGG 1 cut(s) 74
AluBI AGCT 2 cut(s) 32, 165
AluI AGCT 2 cut(s) 32, 165
Alw26I GTCTC 1 cut(s) 73
AlwI GGATC 2 cut(s) 59, 164
BaeGI GKGCMC 1 cut(s) 186
BccI CCATC 1 cut(s) 107
BcoDI GTCTC 1 cut(s) 73
BfmI CTRYAG 1 cut(s) 160
BfuAI ACCTGC 1 cut(s) 193
BmsI GCATC 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 128
BsaI GGTCTC 1 cut(s) 73
BsaXI ACNNNNNCTCC 2 cut(s) 70, 100
Bsc4I CCNNNNNNNGG 1 cut(s) 74
Bse1I ACTGG 1 cut(s) 68
BseGI GGATG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 74
BseNI ACTGG 1 cut(s) 68
BseRI GAGGAG 1 cut(s) 24
BseSI GKGCMC 1 cut(s) 186
BslI CCNNNNNNNGG 1 cut(s) 74
BsmAI GTCTC 1 cut(s) 73
Bso31I GGTCTC 1 cut(s) 73
Bsp1286I GDGCHC 1 cut(s) 186
Bsp143I GATC 2 cut(s) 64, 156
BspACI CCGC 1 cut(s) 8
BspMI ACCTGC 1 cut(s) 193
BspPI GGATC 2 cut(s) 59, 164
BspTNI GGTCTC 1 cut(s) 73
BsrI ACTGG 1 cut(s) 68
BssMI GATC 2 cut(s) 64, 156
Bst6I CTCTTC 1 cut(s) 42
BstF5I GGATG 1 cut(s) 118
BstKTI GATC 2 cut(s) 67, 159
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 2 cut(s) 64, 156
BstSFI CTRYAG 1 cut(s) 160
BstSLI GKGCMC 1 cut(s) 186
BstX2I RGATCY 1 cut(s) 156
BstYI RGATCY 1 cut(s) 156
BtsCI GGATG 1 cut(s) 118
BveI ACCTGC 1 cut(s) 193
CviAII CATG 1 cut(s) 41
CviJI RGCY 2 cut(s) 32, 165
CviKI_1 RGCY 2 cut(s) 32, 165
DpnI GATC 2 cut(s) 66, 158
DpnII GATC 2 cut(s) 64, 156
Eam1104I CTCTTC 1 cut(s) 42
EarI CTCTTC 1 cut(s) 42
Eco31I GGTCTC 1 cut(s) 73
FaeI CATG 1 cut(s) 44
FaiI YATR 3 cut(s) 42, 162, 168
FalI AAGNNNNNCTT 2 cut(s) 21, 53
FatI CATG 1 cut(s) 40
FokI GGATG 1 cut(s) 125
Hin1II CATG 1 cut(s) 44
Hpy188III TCNNGA 2 cut(s) 107, 154
HpyAV CCTTC 1 cut(s) 173
HpyCH4V TGCA 2 cut(s) 55, 202
Hsp92II CATG 1 cut(s) 44
Kzo9I GATC 2 cut(s) 64, 156
LmnI GCTCC 2 cut(s) 37, 147
LpnPI CCDG 5 cut(s) 60, 81, 130, 139, 188
LweI GCATC 1 cut(s) 159
MaeIII GTNAC 1 cut(s) 70
MalI GATC 2 cut(s) 66, 158
MboI GATC 2 cut(s) 64, 156
MboII GAAGA 1 cut(s) 29
MflI RGATCY 1 cut(s) 156
MhlI GDGCHC 1 cut(s) 186
MnlI CCTC 4 cut(s) 45, 55, 103, 132
MseI TTAA 1 cut(s) 99
NdeII GATC 2 cut(s) 64, 156
NlaIII CATG 1 cut(s) 44
PsuI RGATCY 1 cut(s) 156
SaqAI TTAA 1 cut(s) 99
Sau3AI GATC 2 cut(s) 64, 156
SduI GDGCHC 1 cut(s) 186
SetI ASST 5 cut(s) 34, 85, 167, 194, 207
SfaNI GCATC 1 cut(s) 159
SfcI CTRYAG 1 cut(s) 160
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
SsiI CCGC 1 cut(s) 8
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TspDTI ATGAA 3 cut(s) 17, 29, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.