Rh3DG297300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
31049960 .. 31082350
32391 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG297300.1

Sequence Viewer

Length: 198 bp
ATGGGAATGAAAACCGAACTTAACCCGTTGCTTGTATTGTCTGTTGCCAGTCCAGTCTACTTTTATTTTAGATTAATTAGTGTCTTGGATGTGGGGTTCAATGTGGTTTTTAGCGACTTAAAGGCCCAGAATCTATTTGGTTTTCTTTGGTGGACTATCATGGGGAAGAGAGAGGAGGAGGAAGAATTAAGCCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.52

Weight (kDa)

4.6

Isoelectric Point (pI)

55.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 57
AgsI TTSAA 1 cut(s) 100
AloI GAACNNNNNNTCC 2 cut(s) 80, 112
AoxI GGCC 1 cut(s) 123
AseI ATTAAT 1 cut(s) 74
AspS9I GGNCC 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 124
Bse1I ACTGG 2 cut(s) 48, 53
BseGI GGATG 1 cut(s) 94
BseNI ACTGG 2 cut(s) 48, 53
BseRI GAGGAG 2 cut(s) 188, 191
BshFI GGCC 1 cut(s) 125
BsnI GGCC 1 cut(s) 125
BspANI GGCC 1 cut(s) 125
BsrI ACTGG 2 cut(s) 48, 53
Bst6I CTCTTC 1 cut(s) 161
BstDEI CTNAG 1 cut(s) 195
BstF5I GGATG 1 cut(s) 94
BsuRI GGCC 1 cut(s) 125
BtsCI GGATG 1 cut(s) 94
Cfr13I GGNCC 1 cut(s) 124
CviAII CATG 1 cut(s) 160
CviJI RGCY 2 cut(s) 125, 192
CviKI_1 RGCY 2 cut(s) 125, 192
DdeI CTNAG 1 cut(s) 195
Eam1104I CTCTTC 1 cut(s) 161
EarI CTCTTC 1 cut(s) 161
FaeI CATG 1 cut(s) 163
FaiI YATR 1 cut(s) 161
FatI CATG 1 cut(s) 159
FblI GTMKAC 1 cut(s) 57
FokI GGATG 1 cut(s) 101
HaeIII GGCC 1 cut(s) 125
Hin1II CATG 1 cut(s) 163
HinfI GANTC 1 cut(s) 130
Hpy166II GTNNAC 2 cut(s) 58, 153
Hpy8I GTNNAC 2 cut(s) 58, 153
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 1 cut(s) 163
LpnPI CCDG 3 cut(s) 61, 66, 140
MboII GAAGA 2 cut(s) 178, 194
MluCI AATT 2 cut(s) 75, 185
MnlI CCTC 3 cut(s) 166, 169, 172
MseI TTAA 4 cut(s) 21, 74, 119, 188
NlaIII CATG 1 cut(s) 163
PfeI GAWTC 1 cut(s) 130
PshBI ATTAAT 1 cut(s) 74
PspPI GGNCC 1 cut(s) 124
SaqAI TTAA 4 cut(s) 21, 74, 119, 188
Sau96I GGNCC 1 cut(s) 124
SgeI CNNG 7 cut(s) 37, 44, 60, 65, 97, 139, 172
Sse9I AATT 2 cut(s) 75, 185
TasI AATT 2 cut(s) 75, 185
TfiI GAWTC 1 cut(s) 130
Tru1I TTAA 4 cut(s) 21, 74, 119, 188
Tru9I TTAA 4 cut(s) 21, 74, 119, 188
TspDTI ATGAA 1 cut(s) 23
VspI ATTAAT 1 cut(s) 74
XcmI CCANNNNNNNNNTGG 1 cut(s) 134
XmiI GTMKAC 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.