RchiOBHm_Chr5g0080341

CCR4-NOT transcription complex subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
86300408 .. 86302690
2283 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35466

Sequence Viewer

Length: 324 bp
ATGCAAACATGTATCCACAAGGTTCTATGGGTGTTGTGCCAGAAGCTCTCCGCCCTAAACCTGGTCATTTGTCCCTTTCTCAGCAACGAGTTTATGAGTATTATGTGTAAGAGTGCTTCATCTATTCATGTTGGGGCGGCTGATGGTGTTTCCCAGCATAGTTCTGAAAATGATTCTGTTGTTGCCTCATTTCCTTCTGCTGCTTCTGCCCCTGAGCTGCACTCTGTAGAGTCATCTGATGCTGTAAAGGTTGACGAAACTTCTTTCATGATTGTAGGGTGGAATCTGGAGTGTCCTCACAGCCACCACCTTCACCTGCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

107

Amino Acids

11.58

Weight (kDa)

5.62

Isoelectric Point (pI)

41.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 51, 137
AfiI CCNNNNNNNGG 1 cut(s) 61
AflIII ACRYGT 1 cut(s) 8
AjnI CCWGG 1 cut(s) 60
AluBI AGCT 2 cut(s) 46, 217
AluI AGCT 2 cut(s) 46, 217
ApeKI GCWGC 2 cut(s) 200, 217
AsuHPI GGTGA 1 cut(s) 305
BarI GAAGNNNNNNTAC 2 cut(s) 100, 132
BbvI GCAGC 2 cut(s) 187, 204
BccI CCATC 1 cut(s) 137
BciT130I CCWGG 1 cut(s) 62
BciVI GTATCC 1 cut(s) 23
BfmI CTRYAG 1 cut(s) 225
BfuI GTATCC 1 cut(s) 23
BisI GCNGC 3 cut(s) 138, 201, 218
BlsI GCNGC 3 cut(s) 139, 202, 219
Bme1390I CCNGG 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 62
BmsI GCATC 1 cut(s) 229
BplI GAGNNNNNCTC 2 cut(s) 206, 238
BpmI CTGGAG 1 cut(s) 308
Bpu10I CCTNAGC 1 cut(s) 213
Bsc4I CCNNNNNNNGG 1 cut(s) 61
BseBI CCWGG 1 cut(s) 62
BseLI CCNNNNNNNGG 1 cut(s) 61
BseMII CTCAG 2 cut(s) 94, 204
BseXI GCAGC 2 cut(s) 187, 204
BseYI CCCAGC 1 cut(s) 153
BsgI GTGCAG 1 cut(s) 203
BslFI GGGAC 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 61
BsmFI GGGAC 1 cut(s) 57
BspACI CCGC 2 cut(s) 51, 137
BspCNI CTCAG 2 cut(s) 93, 205
BspHI TCATGA 1 cut(s) 267
Bst2UI CCWGG 1 cut(s) 62
BstDEI CTNAG 2 cut(s) 80, 213
BstMWI GCNNNNNNNGC 1 cut(s) 206
BstNI CCWGG 1 cut(s) 62
BstNSI RCATGY 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 60
BstSFI CTRYAG 1 cut(s) 225
BstV1I GCAGC 2 cut(s) 187, 204
BsuI GTATCC 1 cut(s) 23
CciI TCATGA 1 cut(s) 267
CsiI ACCWGGT 1 cut(s) 60
CviAII CATG 3 cut(s) 9, 128, 268
CviJI RGCY 4 cut(s) 46, 140, 217, 303
CviKI_1 RGCY 4 cut(s) 46, 140, 217, 303
DdeI CTNAG 2 cut(s) 80, 213
EciI GGCGGA 1 cut(s) 40
EcoRII CCWGG 1 cut(s) 60
FaeI CATG 3 cut(s) 12, 131, 271
FaiI YATR 7 cut(s) 10, 28, 95, 104, 129, 159, 269
FaqI GGGAC 1 cut(s) 57
FatI CATG 3 cut(s) 8, 127, 267
Fnu4HI GCNGC 3 cut(s) 138, 201, 218
Fsp4HI GCNGC 3 cut(s) 138, 201, 218
GluI GCNGC 3 cut(s) 138, 201, 218
GsaI CCCAGC 1 cut(s) 157
GsuI CTGGAG 1 cut(s) 308
Hin1II CATG 3 cut(s) 12, 131, 271
HincII GTYRAC 1 cut(s) 253
HindII GTYRAC 1 cut(s) 253
HinfI GANTC 3 cut(s) 173, 230, 283
HphI GGTGA 1 cut(s) 305
Hpy166II GTNNAC 1 cut(s) 253
Hpy188I TCNGA 2 cut(s) 166, 238
Hpy188III TCNNGA 2 cut(s) 268, 287
Hpy8I GTNNAC 1 cut(s) 253
HpyAV CCTTC 2 cut(s) 204, 320
HpyCH4V TGCA 2 cut(s) 4, 220
HpyF10VI GCNNNNNNNGC 1 cut(s) 206
HpyF3I CTNAG 2 cut(s) 80, 213
Hsp92II CATG 3 cut(s) 12, 131, 271
LpnPI CCDG 6 cut(s) 47, 53, 74, 167, 225, 272
Lsp1109I GCAGC 2 cut(s) 187, 204
LweI GCATC 1 cut(s) 229
MabI ACCWGGT 1 cut(s) 60
MlyI GAGTC 1 cut(s) 239
MnlI CCTC 2 cut(s) 196, 306
MspR9I CCNGG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 62
MwoI GCNNNNNNNGC 1 cut(s) 206
NlaIII CATG 3 cut(s) 12, 131, 271
NspI RCATGY 1 cut(s) 12
PagI TCATGA 1 cut(s) 267
PciI ACATGT 1 cut(s) 8
PfeI GAWTC 2 cut(s) 173, 283
PkrI GCNGC 3 cut(s) 139, 202, 219
PleI GAGTC 1 cut(s) 238
PpsI GAGTC 1 cut(s) 238
PscI ACATGT 1 cut(s) 8
Psp6I CCWGG 1 cut(s) 60
PspFI CCCAGC 1 cut(s) 153
PspGI CCWGG 1 cut(s) 60
SatI GCNGC 3 cut(s) 138, 201, 218
SchI GAGTC 1 cut(s) 239
ScrFI CCNGG 1 cut(s) 62
SetI ASST 7 cut(s) 24, 48, 63, 219, 252, 312, 318
SexAI ACCWGGT 1 cut(s) 60
SfaNI GCATC 1 cut(s) 229
SfcI CTRYAG 1 cut(s) 225
SsiI CCGC 2 cut(s) 51, 137
StyD4I CCNGG 1 cut(s) 60
TauI GCSGC 1 cut(s) 140
TfiI GAWTC 2 cut(s) 173, 283
TseI GCWGC 2 cut(s) 200, 217
TspDTI ATGAA 3 cut(s) 108, 116, 256
XceI RCATGY 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.