RchiOBHm_Chr4g0416011

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
40843427 .. 40844529
1103 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38618

Sequence Viewer

Length: 162 bp
ATGATGAAGTTATTGGCTGAAAGTTTGGATATCTTGTATCACATGTCTTCGTCCTTTCCGAGCTTTGTTGCTAAGGTGGTAACTTGGTATCTACTAGAGGTGTTAATGGTGGAAAAGAAGCCTCAGGTTCTTGCTCTTGTACCAAAATCCAGTAGCCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.02

Weight (kDa)

8.11

Isoelectric Point (pI)

45.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 141
AflIII ACRYGT 1 cut(s) 42
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
AxyI CCTNAGG 1 cut(s) 123
BbsI GAAGAC 1 cut(s) 39
BfaI CTAG 2 cut(s) 95, 160
BpiI GAAGAC 1 cut(s) 39
Bpu10I CCTNAGC 1 cut(s) 72
Bse1I ACTGG 1 cut(s) 150
Bse21I CCTNAGG 1 cut(s) 123
BseMII CTCAG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 150
BspCNI CTCAG 1 cut(s) 136
BsrI ACTGG 1 cut(s) 150
BstDEI CTNAG 2 cut(s) 72, 123
BstNSI RCATGY 1 cut(s) 46
BstV2I GAAGAC 1 cut(s) 39
Bsu36I CCTNAGG 1 cut(s) 123
Csp6I GTAC 1 cut(s) 140
CviAII CATG 1 cut(s) 43
CviJI RGCY 4 cut(s) 17, 63, 121, 156
CviKI_1 RGCY 4 cut(s) 17, 63, 121, 156
CviQI GTAC 1 cut(s) 140
DdeI CTNAG 2 cut(s) 72, 123
Eco32I GATATC 1 cut(s) 31
Eco81I CCTNAGG 1 cut(s) 123
EcoRV GATATC 1 cut(s) 31
FaeI CATG 1 cut(s) 46
FaiI YATR 1 cut(s) 44
FatI CATG 1 cut(s) 42
FspBI CTAG 2 cut(s) 95, 160
Hin1II CATG 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 60
HpyF3I CTNAG 2 cut(s) 72, 123
Hsp92II CATG 1 cut(s) 46
LpnPI CCDG 1 cut(s) 110
MaeI CTAG 2 cut(s) 95, 160
MaeIII GTNAC 1 cut(s) 79
MboII GAAGA 1 cut(s) 39
MnlI CCTC 2 cut(s) 91, 132
MseI TTAA 1 cut(s) 104
NlaIII CATG 1 cut(s) 46
NspI RCATGY 1 cut(s) 46
PciI ACATGT 1 cut(s) 42
PcsI WCGNNNNNNNCGW 1 cut(s) 56
PscI ACATGT 1 cut(s) 42
RsaI GTAC 1 cut(s) 141
RsaNI GTAC 1 cut(s) 140
SaqAI TTAA 1 cut(s) 104
SetI ASST 4 cut(s) 65, 78, 102, 129
SgeI CNNG 8 cut(s) 46, 55, 72, 96, 107, 137, 143, 149
SspMI CTAG 2 cut(s) 95, 160
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TspDTI ATGAA 1 cut(s) 20
XceI RCATGY 1 cut(s) 46
XspI CTAG 2 cut(s) 95, 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.