Rmu_sc0000683.1_g000005

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000683.1
Physical Location & Seq
Forward (+)
38946 .. 39329
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000683.1_g000005.1.cds

Sequence Viewer

Length: 279 bp
atgggtgaagcagtcaaggtagttgttccagagtctgttctaaagaagaggaagacagaggaggaatgggccttggcaaagacgcaggggcttgaatccaccaagaaaaagaatgctgagaataggaagcttatttacaacaaatccaaacagtacaccaaggagtacgcagagaaggacaatgagttggtccggttgaagcgtgaagcaaggctaaaaggaggattctatgtcaagccagagtctaagctttcgtttatcattcgtatccatgggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.71

Weight (kDa)

9.87

Isoelectric Point (pI)

36.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 155, 167
AgsI TTSAA 2 cut(s) 95, 199
AluBI AGCT 2 cut(s) 130, 250
AluI AGCT 2 cut(s) 130, 250
AlwNI CAGNNNCTG 1 cut(s) 35
AoxI GGCC 1 cut(s) 69
AspS9I GGNCC 2 cut(s) 69, 190
AsuHPI GGTGA 1 cut(s) 17
AvaII GGWCC 1 cut(s) 190
BarI GAAGNNNNNNTAC 2 cut(s) 119, 151
BbsI GAAGAC 1 cut(s) 59
BciVI GTATCC 1 cut(s) 278
BfuI GTATCC 1 cut(s) 278
Bme18I GGWCC 1 cut(s) 190
BmgT120I GGNCC 2 cut(s) 69, 190
BpiI GAAGAC 1 cut(s) 59
BsaJI CCNNGG 3 cut(s) 72, 159, 271
BsaWI WCCGGW 1 cut(s) 192
BseDI CCNNGG 3 cut(s) 72, 159, 271
BseMII CTCAG 1 cut(s) 108
BseRI GAGGAG 1 cut(s) 74
BshFI GGCC 1 cut(s) 71
BsiSI CCGG 1 cut(s) 193
BsmI GAATGC 1 cut(s) 118
BsnI GGCC 1 cut(s) 71
Bsp19I CCATGG 1 cut(s) 271
BspANI GGCC 1 cut(s) 71
BspCNI CTCAG 1 cut(s) 109
BssECI CCNNGG 3 cut(s) 72, 159, 271
BssT1I CCWWGG 3 cut(s) 72, 159, 271
Bst4CI ACNGT 1 cut(s) 153
Bst6I CTCTTC 1 cut(s) 41
BstDEI CTNAG 2 cut(s) 117, 246
BstDSI CCRYGG 1 cut(s) 271
BstV2I GAAGAC 1 cut(s) 59
BsuI GTATCC 1 cut(s) 278
BsuRI GGCC 1 cut(s) 71
BtgI CCRYGG 1 cut(s) 271
CaiI CAGNNNCTG 1 cut(s) 35
Cfr13I GGNCC 2 cut(s) 69, 190
CseI GACGC 1 cut(s) 91
Csp6I GTAC 2 cut(s) 154, 166
CviAII CATG 1 cut(s) 272
CviJI RGCY 6 cut(s) 71, 91, 130, 214, 238, 250
CviKI_1 RGCY 6 cut(s) 71, 91, 130, 214, 238, 250
CviQI GTAC 2 cut(s) 154, 166
DdeI CTNAG 2 cut(s) 117, 246
Eam1104I CTCTTC 1 cut(s) 41
EarI CTCTTC 1 cut(s) 41
Eco130I CCWWGG 3 cut(s) 72, 159, 271
Eco47I GGWCC 1 cut(s) 190
EcoT14I CCWWGG 3 cut(s) 72, 159, 271
ErhI CCWWGG 3 cut(s) 72, 159, 271
FaeI CATG 1 cut(s) 275
FaiI YATR 2 cut(s) 231, 273
FatI CATG 1 cut(s) 271
HaeIII GGCC 1 cut(s) 71
HapII CCGG 1 cut(s) 193
HgaI GACGC 1 cut(s) 91
Hin1II CATG 1 cut(s) 275
HindIII AAGCTT 2 cut(s) 128, 248
HinfI GANTC 4 cut(s) 32, 95, 225, 242
HpaII CCGG 1 cut(s) 193
HphI GGTGA 1 cut(s) 17
Hpy166II GTNNAC 1 cut(s) 156
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 1 cut(s) 156
HpyAV CCTTC 1 cut(s) 169
HpyCH4III ACNGT 1 cut(s) 153
HpyF3I CTNAG 2 cut(s) 117, 246
Hsp92II CATG 1 cut(s) 275
LpnPI CCDG 4 cut(s) 42, 71, 206, 252
MboII GAAGA 2 cut(s) 58, 64
MlyI GAGTC 2 cut(s) 41, 251
MnlI CCTC 4 cut(s) 42, 52, 55, 215
MspI CCGG 1 cut(s) 193
Mva1269I GAATGC 1 cut(s) 118
NcoI CCATGG 1 cut(s) 271
NlaIII CATG 1 cut(s) 275
PctI GAATGC 1 cut(s) 118
PfeI GAWTC 2 cut(s) 95, 225
PleI GAGTC 2 cut(s) 40, 250
PpsI GAGTC 2 cut(s) 40, 250
PspPI GGNCC 2 cut(s) 69, 190
PstNI CAGNNNCTG 1 cut(s) 35
RsaI GTAC 2 cut(s) 155, 167
RsaNI GTAC 2 cut(s) 154, 166
Sau96I GGNCC 2 cut(s) 69, 190
SchI GAGTC 2 cut(s) 41, 251
SetI ASST 3 cut(s) 21, 132, 252
SinI GGWCC 1 cut(s) 190
StyI CCWWGG 3 cut(s) 72, 159, 271
TaaI ACNGT 1 cut(s) 153
TatI WGTACW 1 cut(s) 153
TfiI GAWTC 2 cut(s) 95, 225
VpaK11BI GGWCC 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.