Rh1CG146400

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
31875973 .. 31876592
620 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG146400.1

Sequence Viewer

Length: 255 bp
ATGTTTTCGTCCTTTCCGAGCTTTGTTGCCAAGGTGGTAACTTGGTATCTGCTAGAGGTGTTAATGGTGGAAAAGAAGCCTCAGGTTCCTGCTCCTGCAGCAAAATCCAGTAGCCAAGGTAATAGAAAAGATCTGAGTTTAAAAGATCCGAGCTTTGTTGCCAAGGACAACGAGTTGGTCCGGTTGAAGCGTGAAGCAATGTTGAAAGGAGGATTATATGTTGAACCAGAGTATGTCTTATCAATAAACTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.46

Weight (kDa)

9.3

Isoelectric Point (pI)

34.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 140
AgsI TTSAA 3 cut(s) 187, 205, 224
AluBI AGCT 2 cut(s) 21, 153
AluI AGCT 2 cut(s) 21, 153
AlwI GGATC 1 cut(s) 140
ApeKI GCWGC 1 cut(s) 98
AspS9I GGNCC 1 cut(s) 178
AvaII GGWCC 1 cut(s) 178
AxyI CCTNAGG 1 cut(s) 81
BbvI GCAGC 1 cut(s) 110
BfaI CTAG 1 cut(s) 53
BfmI CTRYAG 1 cut(s) 96
BglII AGATCT 1 cut(s) 130
BisI GCNGC 1 cut(s) 99
BlsI GCNGC 1 cut(s) 100
Bme18I GGWCC 1 cut(s) 178
BmgT120I GGNCC 1 cut(s) 178
BmiI GGNNCC 1 cut(s) 87
BsaJI CCNNGG 3 cut(s) 30, 115, 162
BsaWI WCCGGW 1 cut(s) 180
Bse1I ACTGG 1 cut(s) 108
Bse21I CCTNAGG 1 cut(s) 81
Bse3DI GCAATG 1 cut(s) 204
BseDI CCNNGG 3 cut(s) 30, 115, 162
BseMI GCAATG 1 cut(s) 204
BseMII CTCAG 2 cut(s) 95, 125
BseNI ACTGG 1 cut(s) 108
BseXI GCAGC 1 cut(s) 110
BsiSI CCGG 1 cut(s) 181
Bsp143I GATC 2 cut(s) 130, 145
BspCNI CTCAG 2 cut(s) 94, 126
BspLI GGNNCC 1 cut(s) 87
BspMAI CTGCAG 1 cut(s) 100
BspPI GGATC 1 cut(s) 140
BsrDI GCAATG 1 cut(s) 204
BsrI ACTGG 1 cut(s) 108
BssECI CCNNGG 3 cut(s) 30, 115, 162
BssMI GATC 2 cut(s) 130, 145
BssT1I CCWWGG 3 cut(s) 30, 115, 162
BstDEI CTNAG 2 cut(s) 81, 134
BstKTI GATC 2 cut(s) 133, 148
BstMBI GATC 2 cut(s) 130, 145
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstSFI CTRYAG 1 cut(s) 96
BstV1I GCAGC 1 cut(s) 110
BstX2I RGATCY 2 cut(s) 130, 145
BstYI RGATCY 2 cut(s) 130, 145
Bsu36I CCTNAGG 1 cut(s) 81
Cfr13I GGNCC 1 cut(s) 178
CviJI RGCY 4 cut(s) 21, 79, 114, 153
CviKI_1 RGCY 4 cut(s) 21, 79, 114, 153
DdeI CTNAG 2 cut(s) 81, 134
DpnI GATC 2 cut(s) 132, 147
DpnII GATC 2 cut(s) 130, 145
DraI TTTAAA 1 cut(s) 141
Eco130I CCWWGG 3 cut(s) 30, 115, 162
Eco47I GGWCC 1 cut(s) 178
Eco81I CCTNAGG 1 cut(s) 81
EcoT14I CCWWGG 3 cut(s) 30, 115, 162
ErhI CCWWGG 3 cut(s) 30, 115, 162
FaiI YATR 3 cut(s) 217, 219, 234
Fnu4HI GCNGC 1 cut(s) 99
Fsp4HI GCNGC 1 cut(s) 99
FspBI CTAG 1 cut(s) 53
GluI GCNGC 1 cut(s) 99
HapII CCGG 1 cut(s) 181
HpaII CCGG 1 cut(s) 181
Hpy188I TCNGA 3 cut(s) 18, 135, 150
HpyCH4V TGCA 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
HpyF3I CTNAG 2 cut(s) 81, 134
Kzo9I GATC 2 cut(s) 130, 145
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 6 cut(s) 68, 102, 108, 121, 194, 240
Lsp1109I GCAGC 1 cut(s) 110
MaeI CTAG 1 cut(s) 53
MaeIII GTNAC 1 cut(s) 37
MalI GATC 2 cut(s) 132, 147
MboI GATC 2 cut(s) 130, 145
MflI RGATCY 2 cut(s) 130, 145
MnlI CCTC 3 cut(s) 49, 90, 203
MseI TTAA 2 cut(s) 62, 140
MspI CCGG 1 cut(s) 181
MwoI GCNNNNNNNGC 1 cut(s) 98
NdeII GATC 2 cut(s) 130, 145
NlaIV GGNNCC 1 cut(s) 87
PcsI WCGNNNNNNNCGW 1 cut(s) 14
PkrI GCNGC 1 cut(s) 100
PspN4I GGNNCC 1 cut(s) 87
PspPI GGNCC 1 cut(s) 178
PstI CTGCAG 1 cut(s) 100
PsuI RGATCY 2 cut(s) 130, 145
SaqAI TTAA 2 cut(s) 62, 140
SatI GCNGC 1 cut(s) 99
Sau3AI GATC 2 cut(s) 130, 145
Sau96I GGNCC 1 cut(s) 178
SetI ASST 6 cut(s) 23, 36, 60, 87, 121, 155
SfcI CTRYAG 1 cut(s) 96
SinI GGWCC 1 cut(s) 178
SspMI CTAG 1 cut(s) 53
StyI CCWWGG 3 cut(s) 30, 115, 162
Tru1I TTAA 2 cut(s) 62, 140
Tru9I TTAA 2 cut(s) 62, 140
TseI GCWGC 1 cut(s) 98
VpaK11BI GGWCC 1 cut(s) 178
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.