Rh5CG070700

60S ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0004257
Physical Location & Seq
Forward (+)
5296069 .. 5296692
624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG070700.1

Sequence Viewer

Length: 198 bp
ATGGAGGACACGATGCCCATTCGCAAGACTGATACTTTAACTCCGATTGGTGAAGTAGTCAAGGTAGTGGTTCCGGAGTCTGTTCTAAAGAAGAGGAAGAGAGAGGAGGAATGGGCCTTGGCAAAGAAGCAGGGGCTTGAAGCCACCAAGAAGAAGAATGCTGAGAATAGGAAGCTTATTTACAAGAAATCCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L30 Ribosomal_L30_N

Protein Analysis

65

Amino Acids

7.54

Weight (kDa)

9.94

Isoelectric Point (pI)

37.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L30_N PF08079 24 - 64 2.4e-08 Ribosomal L30 N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 73
AgsI TTSAA 1 cut(s) 140
AluBI AGCT 1 cut(s) 175
AluI AGCT 1 cut(s) 175
Aor13HI TCCGGA 1 cut(s) 73
AoxI GGCC 1 cut(s) 114
AspS9I GGNCC 1 cut(s) 114
AsuHPI GGTGA 1 cut(s) 62
BarI GAAGNNNNNNTAC 2 cut(s) 164, 196
BmgT120I GGNCC 1 cut(s) 114
BmiI GGNNCC 1 cut(s) 72
BmsI GCATC 1 cut(s) 3
BsaJI CCNNGG 1 cut(s) 117
BsaWI WCCGGW 1 cut(s) 73
BsaXI ACNNNNNCTCC 2 cut(s) 25, 55
BseAI TCCGGA 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 117
BseMII CTCAG 1 cut(s) 153
BseRI GAGGAG 1 cut(s) 119
BshFI GGCC 1 cut(s) 116
BsiSI CCGG 1 cut(s) 74
BsmI GAATGC 1 cut(s) 163
BsnI GGCC 1 cut(s) 116
Bsp13I TCCGGA 1 cut(s) 73
BspANI GGCC 1 cut(s) 116
BspCNI CTCAG 1 cut(s) 154
BspEI TCCGGA 1 cut(s) 73
BspLI GGNNCC 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 117
BssT1I CCWWGG 1 cut(s) 117
Bst6I CTCTTC 2 cut(s) 86, 92
BstDEI CTNAG 1 cut(s) 162
BsuRI GGCC 1 cut(s) 116
Cfr13I GGNCC 1 cut(s) 114
CviJI RGCY 4 cut(s) 116, 136, 143, 175
CviKI_1 RGCY 4 cut(s) 116, 136, 143, 175
DdeI CTNAG 1 cut(s) 162
Eam1104I CTCTTC 2 cut(s) 86, 92
EarI CTCTTC 2 cut(s) 86, 92
Eco130I CCWWGG 1 cut(s) 117
EcoT14I CCWWGG 1 cut(s) 117
ErhI CCWWGG 1 cut(s) 117
HaeIII GGCC 1 cut(s) 116
HapII CCGG 1 cut(s) 74
HindIII AAGCTT 1 cut(s) 173
HinfI GANTC 1 cut(s) 77
HpaII CCGG 1 cut(s) 74
HphI GGTGA 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 162
Kpn2I TCCGGA 1 cut(s) 73
LpnPI CCDG 2 cut(s) 87, 116
LweI GCATC 1 cut(s) 3
MboII GAAGA 4 cut(s) 103, 109, 163, 166
MlyI GAGTC 1 cut(s) 86
MnlI CCTC 3 cut(s) 87, 97, 100
MroI TCCGGA 1 cut(s) 73
MseI TTAA 1 cut(s) 38
MspI CCGG 1 cut(s) 74
Mva1269I GAATGC 1 cut(s) 163
NlaIV GGNNCC 1 cut(s) 72
PctI GAATGC 1 cut(s) 163
PleI GAGTC 1 cut(s) 85
PpsI GAGTC 1 cut(s) 85
PspN4I GGNNCC 1 cut(s) 72
PspPI GGNCC 1 cut(s) 114
SaqAI TTAA 1 cut(s) 38
Sau96I GGNCC 1 cut(s) 114
SchI GAGTC 1 cut(s) 86
SetI ASST 2 cut(s) 66, 177
SfaNI GCATC 1 cut(s) 3
SgeI CNNG 8 cut(s) 22, 37, 73, 86, 130, 143, 149, 160
StyI CCWWGG 1 cut(s) 117
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.