Rh1DG119900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
21837990 .. 21846636
8647 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG119900.1

Sequence Viewer

Length: 219 bp
ATGGACAAGGAAAGCATAGGGAATAATGGGAAGAATGAGGGGAAGGGGAGTATAGCTTCATACATAGTCCTAGAAGAATGCCAGGGTATGGGAATTATCAATGCCATTGATCCAAAGACAAAGAAGATCTTGCAGCTTTTGCGTTTGAGACAGAAAATACCAATAAGGCTACAATTCATCACAAATATAATCTGTGTCTTGAGGCACCGAGTTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.15

Weight (kDa)

9.62

Isoelectric Point (pI)

33.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 204
AccB7I CCANNNNNTGG 1 cut(s) 88
AclWI GGATC 1 cut(s) 104
AfiI CCNNNNNNNGG 1 cut(s) 88
AjnI CCWGG 1 cut(s) 81
AluBI AGCT 2 cut(s) 56, 136
AluI AGCT 2 cut(s) 56, 136
Alw26I GTCTC 1 cut(s) 142
AlwI GGATC 1 cut(s) 104
ApeKI GCWGC 1 cut(s) 133
BanI GGYRCC 1 cut(s) 204
BbvI GCAGC 1 cut(s) 145
BciT130I CCWGG 1 cut(s) 83
BcoDI GTCTC 1 cut(s) 142
BfaI CTAG 1 cut(s) 71
BglII AGATCT 1 cut(s) 126
BisI GCNGC 1 cut(s) 134
BlsI GCNGC 1 cut(s) 135
Bme1390I CCNGG 1 cut(s) 83
BmiI GGNNCC 1 cut(s) 206
BmrFI CCNGG 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 82
Bsc4I CCNNNNNNNGG 1 cut(s) 88
BseBI CCWGG 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 88
BseXI GCAGC 1 cut(s) 145
BshNI GGYRCC 1 cut(s) 204
BslI CCNNNNNNNGG 1 cut(s) 88
BsmAI GTCTC 1 cut(s) 142
BsmI GAATGC 1 cut(s) 83
Bsp143I GATC 2 cut(s) 109, 126
BspLI GGNNCC 1 cut(s) 206
BspPI GGATC 1 cut(s) 104
BspT107I GGYRCC 1 cut(s) 204
BssECI CCNNGG 1 cut(s) 82
BssMI GATC 2 cut(s) 109, 126
Bst2UI CCWGG 1 cut(s) 83
BstAPI GCANNNNNTGC 1 cut(s) 139
BstKTI GATC 2 cut(s) 112, 129
BstMAI GTCTC 1 cut(s) 142
BstMBI GATC 2 cut(s) 109, 126
BstMWI GCNNNNNNNGC 1 cut(s) 139
BstNI CCWGG 1 cut(s) 83
BstSCI CCNGG 1 cut(s) 81
BstV1I GCAGC 1 cut(s) 145
BstX2I RGATCY 1 cut(s) 126
BstYI RGATCY 1 cut(s) 126
CviJI RGCY 3 cut(s) 56, 136, 169
CviKI_1 RGCY 3 cut(s) 56, 136, 169
DpnI GATC 2 cut(s) 111, 128
DpnII GATC 2 cut(s) 109, 126
EcoRII CCWGG 1 cut(s) 81
FaiI YATR 6 cut(s) 17, 53, 61, 65, 89, 188
FalI AAGNNNNNCTT 2 cut(s) 113, 145
Fnu4HI GCNGC 1 cut(s) 134
Fsp4HI GCNGC 1 cut(s) 134
FspBI CTAG 1 cut(s) 71
GluI GCNGC 1 cut(s) 134
Hpy188III TCNNGA 1 cut(s) 199
HpyAV CCTTC 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 133
HpyF10VI GCNNNNNNNGC 1 cut(s) 139
Kzo9I GATC 2 cut(s) 109, 126
LpnPI CCDG 2 cut(s) 68, 95
Lsp1109I GCAGC 1 cut(s) 145
MaeI CTAG 1 cut(s) 71
MalI GATC 2 cut(s) 111, 128
MboI GATC 2 cut(s) 109, 126
MboII GAAGA 3 cut(s) 43, 86, 136
MflI RGATCY 1 cut(s) 126
MluCI AATT 2 cut(s) 93, 173
MnlI CCTC 2 cut(s) 31, 195
MseI TTAA 1 cut(s) 217
MspR9I CCNGG 1 cut(s) 83
Mva1269I GAATGC 1 cut(s) 83
MvaI CCWGG 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 139
NdeII GATC 2 cut(s) 109, 126
NlaIV GGNNCC 1 cut(s) 206
PctI GAATGC 1 cut(s) 83
PflMI CCANNNNNTGG 1 cut(s) 88
PkrI GCNGC 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 81
PspGI CCWGG 1 cut(s) 81
PspN4I GGNNCC 1 cut(s) 206
PsuI RGATCY 1 cut(s) 126
SaqAI TTAA 1 cut(s) 217
SatI GCNGC 1 cut(s) 134
Sau3AI GATC 2 cut(s) 109, 126
ScrFI CCNGG 1 cut(s) 83
SetI ASST 2 cut(s) 58, 138
SgeI CNNG 6 cut(s) 19, 83, 94, 95, 142, 211
SmlI CTYRAG 1 cut(s) 199
SmoI CTYRAG 1 cut(s) 199
Sse9I AATT 2 cut(s) 93, 173
SspMI CTAG 1 cut(s) 71
StyD4I CCNGG 1 cut(s) 81
TasI AATT 2 cut(s) 93, 173
Tru1I TTAA 1 cut(s) 217
Tru9I TTAA 1 cut(s) 217
TseI GCWGC 1 cut(s) 133
TspDTI ATGAA 2 cut(s) 48, 166
Van91I CCANNNNNTGG 1 cut(s) 88
XspI CTAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.