Rh2AG175000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
16685070 .. 16685675
606 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG175000.1

Sequence Viewer

Length: 177 bp
ATGGGATTCCACTACGACTCTTTCAAAGTTTTGAGATGCAAGATATCTGATATTAGAACTGAGCTTCAACTAATTGCCTTAACAATTCAAAAAGGTAGTTCAAAGATGCAAAGGAGTACGCAGAGAAGTATCAATGCCATTGATCCAAAGACAAAGAAGATCTTGCAACTTTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.69

Weight (kDa)

10.22

Isoelectric Point (pI)

59.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 137
AfaI GTAC 1 cut(s) 118
AgsI TTSAA 4 cut(s) 25, 68, 89, 102
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
AlwI GGATC 1 cut(s) 137
BglII AGATCT 1 cut(s) 159
BmsI GCATC 2 cut(s) 26, 96
BseMII CTCAG 1 cut(s) 51
Bsp143I GATC 2 cut(s) 142, 159
BspCNI CTCAG 1 cut(s) 52
BspPI GGATC 1 cut(s) 137
BssMI GATC 2 cut(s) 142, 159
BstDEI CTNAG 1 cut(s) 60
BstKTI GATC 2 cut(s) 145, 162
BstMBI GATC 2 cut(s) 142, 159
BstX2I RGATCY 1 cut(s) 159
BstYI RGATCY 1 cut(s) 159
Csp6I GTAC 1 cut(s) 117
CviJI RGCY 1 cut(s) 64
CviKI_1 RGCY 1 cut(s) 64
CviQI GTAC 1 cut(s) 117
DdeI CTNAG 1 cut(s) 60
DpnI GATC 2 cut(s) 144, 161
DpnII GATC 2 cut(s) 142, 159
Eco32I GATATC 1 cut(s) 45
EcoRV GATATC 1 cut(s) 45
FalI AAGNNNNNCTT 1 cut(s) 146
FspEI CC 6 cut(s) 23, 78, 91, 97, 151, 159
HinfI GANTC 2 cut(s) 6, 17
Hpy188I TCNGA 1 cut(s) 49
HpyCH4V TGCA 3 cut(s) 39, 109, 166
HpyF3I CTNAG 1 cut(s) 60
Kzo9I GATC 2 cut(s) 142, 159
LweI GCATC 2 cut(s) 26, 96
MalI GATC 2 cut(s) 144, 161
MboI GATC 2 cut(s) 142, 159
MboII GAAGA 1 cut(s) 169
MflI RGATCY 1 cut(s) 159
MluCI AATT 2 cut(s) 72, 84
MlyI GAGTC 1 cut(s) 11
MseI TTAA 1 cut(s) 80
NdeII GATC 2 cut(s) 142, 159
PfeI GAWTC 1 cut(s) 6
PleI GAGTC 1 cut(s) 11
PpsI GAGTC 1 cut(s) 11
PsuI RGATCY 1 cut(s) 159
RsaI GTAC 1 cut(s) 118
RsaNI GTAC 1 cut(s) 117
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 2 cut(s) 142, 159
SchI GAGTC 1 cut(s) 11
SetI ASST 2 cut(s) 66, 97
SfaNI GCATC 2 cut(s) 26, 96
SgeI CNNG 1 cut(s) 52
Sse9I AATT 2 cut(s) 72, 84
TasI AATT 2 cut(s) 72, 84
TfiI GAWTC 1 cut(s) 6
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.