Rroxscaffold_1G00005510

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
7483430 .. 7487038
3609 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00005510.1

Sequence Viewer

Length: 171 bp
ATGGAGGACACGATGCCCGTTCACAAGACCGATACTCTAACTCCGGTGAATATCGATGAAGTAGTCAAGGTACTGGTTCCGGAGTCTGTTCTAAAGAAGAGGAAGAGAGAGGATGGGCCTTGGCAAAGAAACAGGGCCTTGAAGCCACCAGGAAGAAGAATGCGAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.58

Weight (kDa)

9.98

Isoelectric Point (pI)

67.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 79
AfaI GTAC 1 cut(s) 72
AgsI TTSAA 1 cut(s) 142
AjnI CCWGG 1 cut(s) 148
Aor13HI TCCGGA 1 cut(s) 79
AoxI GGCC 2 cut(s) 116, 135
AspS9I GGNCC 2 cut(s) 116, 135
AsuHPI GGTGA 1 cut(s) 58
BccI CCATC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 150
Bme1390I CCNGG 1 cut(s) 150
BmgT120I GGNCC 2 cut(s) 116, 135
BmiI GGNNCC 1 cut(s) 78
BmrFI CCNGG 1 cut(s) 150
BmsI GCATC 1 cut(s) 3
Bsa29I ATCGAT 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 119
BsaWI WCCGGW 2 cut(s) 43, 79
BsaXI ACNNNNNCTCC 2 cut(s) 25, 55
Bse1I ACTGG 1 cut(s) 78
BseAI TCCGGA 1 cut(s) 79
BseBI CCWGG 1 cut(s) 150
BseCI ATCGAT 1 cut(s) 54
BseDI CCNNGG 1 cut(s) 119
BseGI GGATG 1 cut(s) 118
BseNI ACTGG 1 cut(s) 78
BshFI GGCC 2 cut(s) 118, 137
BshVI ATCGAT 1 cut(s) 54
BsiSI CCGG 2 cut(s) 44, 80
BsmI GAATGC 1 cut(s) 165
BsnI GGCC 2 cut(s) 118, 137
Bsp13I TCCGGA 1 cut(s) 79
BspANI GGCC 2 cut(s) 118, 137
BspDI ATCGAT 1 cut(s) 54
BspEI TCCGGA 1 cut(s) 79
BspLI GGNNCC 1 cut(s) 78
BsrI ACTGG 1 cut(s) 78
BssECI CCNNGG 1 cut(s) 119
BssT1I CCWWGG 1 cut(s) 119
Bst2UI CCWGG 1 cut(s) 150
Bst6I CTCTTC 2 cut(s) 92, 98
BstF5I GGATG 1 cut(s) 118
BstNI CCWGG 1 cut(s) 150
BstSCI CCNGG 1 cut(s) 148
Bsu15I ATCGAT 1 cut(s) 54
BsuRI GGCC 2 cut(s) 118, 137
BsuTUI ATCGAT 1 cut(s) 54
BtsCI GGATG 1 cut(s) 118
Cfr13I GGNCC 2 cut(s) 116, 135
ClaI ATCGAT 1 cut(s) 54
Csp6I GTAC 1 cut(s) 71
CviJI RGCY 3 cut(s) 118, 137, 145
CviKI_1 RGCY 3 cut(s) 118, 137, 145
CviQI GTAC 1 cut(s) 71
Eam1104I CTCTTC 2 cut(s) 92, 98
EarI CTCTTC 2 cut(s) 92, 98
Eco130I CCWWGG 1 cut(s) 119
EcoO109I RGGNCCY 1 cut(s) 135
EcoRII CCWGG 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 119
FokI GGATG 1 cut(s) 125
HaeIII GGCC 2 cut(s) 118, 137
HapII CCGG 2 cut(s) 44, 80
HinfI GANTC 1 cut(s) 83
HpaII CCGG 2 cut(s) 44, 80
HphI GGTGA 1 cut(s) 58
Hpy166II GTNNAC 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 22
Kpn2I TCCGGA 1 cut(s) 79
LpnPI CCDG 6 cut(s) 57, 59, 93, 118, 135, 162
LweI GCATC 1 cut(s) 3
MboII GAAGA 4 cut(s) 109, 115, 165, 168
MlyI GAGTC 1 cut(s) 92
MnlI CCTC 2 cut(s) 93, 103
MroI TCCGGA 1 cut(s) 79
MspI CCGG 2 cut(s) 44, 80
MspR9I CCNGG 1 cut(s) 150
Mva1269I GAATGC 1 cut(s) 165
MvaI CCWGG 1 cut(s) 150
NlaIV GGNNCC 1 cut(s) 78
PctI GAATGC 1 cut(s) 165
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 148
PspGI CCWGG 1 cut(s) 148
PspN4I GGNNCC 1 cut(s) 78
PspPI GGNCC 2 cut(s) 116, 135
RsaI GTAC 1 cut(s) 72
RsaNI GTAC 1 cut(s) 71
Sau96I GGNCC 2 cut(s) 116, 135
SchI GAGTC 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 150
SetI ASST 1 cut(s) 72
SfaNI GCATC 1 cut(s) 3
StyD4I CCNGG 1 cut(s) 148
StyI CCWWGG 1 cut(s) 119
TaqI TCGA 1 cut(s) 54
TaqII GACCGA 1 cut(s) 44
TspDTI ATGAA 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.