RchiOBHm_Chr6g0272841

Ribosomal protein L7

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
33282646 .. 33284915
2270 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24478

Sequence Viewer

Length: 165 bp
ATGGTGGAAAAGAAGCCTCCTGTTCCTGCTCCTGCAGCAAAATCCAGTAGCCAAGGTAATAGAAAAGATCTGATTCGGTTGAAGGGTGAAGCAAGGCTAGAAGGAGGATCATATGTTGAACCAGAGTATAAACTCTTGTTTATCGTTCGTCTCAGTGAATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

5.97

Weight (kDa)

9.52

Isoelectric Point (pI)

47.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 115
AgsI TTSAA 2 cut(s) 82, 119
Alw26I GTCTC 1 cut(s) 155
AlwI GGATC 1 cut(s) 115
ApeKI GCWGC 1 cut(s) 35
AsuHPI GGTGA 1 cut(s) 98
BbvI GCAGC 1 cut(s) 47
BcoDI GTCTC 1 cut(s) 155
BfaI CTAG 1 cut(s) 98
BfmI CTRYAG 1 cut(s) 33
BglII AGATCT 1 cut(s) 67
BisI GCNGC 1 cut(s) 36
BlsI GCNGC 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 52
Bse1I ACTGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 52
BseNI ACTGG 1 cut(s) 45
BseXI GCAGC 1 cut(s) 47
BsmAI GTCTC 1 cut(s) 155
BsmBI CGTCTC 1 cut(s) 155
Bsp143I GATC 2 cut(s) 67, 107
BspCNI CTCAG 1 cut(s) 165
BspMAI CTGCAG 1 cut(s) 37
BspPI GGATC 1 cut(s) 115
BsrI ACTGG 1 cut(s) 45
BssECI CCNNGG 1 cut(s) 52
BssMI GATC 2 cut(s) 67, 107
BssT1I CCWWGG 1 cut(s) 52
BstDEI CTNAG 1 cut(s) 152
BstKTI GATC 2 cut(s) 70, 110
BstMAI GTCTC 1 cut(s) 155
BstMBI GATC 2 cut(s) 67, 107
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstSFI CTRYAG 1 cut(s) 33
BstV1I GCAGC 1 cut(s) 47
BstX2I RGATCY 1 cut(s) 67
BstYI RGATCY 1 cut(s) 67
BtsIMutI CAGTG 1 cut(s) 160
CviJI RGCY 3 cut(s) 16, 51, 97
CviKI_1 RGCY 3 cut(s) 16, 51, 97
DdeI CTNAG 1 cut(s) 152
DpnI GATC 2 cut(s) 69, 109
DpnII GATC 2 cut(s) 67, 107
Eco130I CCWWGG 1 cut(s) 52
EcoT14I CCWWGG 1 cut(s) 52
ErhI CCWWGG 1 cut(s) 52
Esp3I CGTCTC 1 cut(s) 155
FaiI YATR 3 cut(s) 112, 114, 129
FauNDI CATATG 1 cut(s) 112
Fnu4HI GCNGC 1 cut(s) 36
Fsp4HI GCNGC 1 cut(s) 36
FspBI CTAG 1 cut(s) 98
GluI GCNGC 1 cut(s) 36
HinfI GANTC 2 cut(s) 73, 158
HphI GGTGA 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 72
HpyAV CCTTC 2 cut(s) 76, 95
HpyCH4V TGCA 1 cut(s) 35
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 152
Kzo9I GATC 2 cut(s) 67, 107
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 5 cut(s) 33, 39, 45, 58, 135
Lsp1109I GCAGC 1 cut(s) 47
MaeI CTAG 1 cut(s) 98
MalI GATC 2 cut(s) 69, 109
MboI GATC 2 cut(s) 67, 107
MflI RGATCY 1 cut(s) 67
MnlI CCTC 2 cut(s) 27, 98
MseI TTAA 1 cut(s) 163
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeI CATATG 1 cut(s) 112
NdeII GATC 2 cut(s) 67, 107
PfeI GAWTC 2 cut(s) 73, 158
PkrI GCNGC 1 cut(s) 37
PstI CTGCAG 1 cut(s) 37
PsuI RGATCY 1 cut(s) 67
SaqAI TTAA 1 cut(s) 163
SatI GCNGC 1 cut(s) 36
Sau3AI GATC 2 cut(s) 67, 107
SetI ASST 1 cut(s) 58
SfcI CTRYAG 1 cut(s) 33
SgeI CNNG 9 cut(s) 32, 38, 44, 57, 65, 105, 110, 134, 148
SspMI CTAG 1 cut(s) 98
StyI CCWWGG 1 cut(s) 52
TfiI GAWTC 2 cut(s) 73, 158
Tru1I TTAA 1 cut(s) 163
Tru9I TTAA 1 cut(s) 163
TscAI CASTG 1 cut(s) 160
TseI GCWGC 1 cut(s) 35
TspRI CASTG 1 cut(s) 160
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.