RchiOBHm_Chr6g0252591

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
7754313 .. 7754635
323 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22650

Sequence Viewer

Length: 225 bp
ATGTCTGCTGCAGTTGATTCAAATGAGGAAAATCATCCTTTACAGCGAATATCACGGGCATTGTGTATCACTCACTCTATTGTTGATGTTGGCCGAGATGATGCTATAAGACAACCAATGAGGCTATATGAGGCTATTGAAAGCATCCAACATATATTACTAGGTAACCAAGTGCAAAATACACGCACATATCAACGTCGGCGGCATGTACAAAACAATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.61

Weight (kDa)

6.9

Isoelectric Point (pI)

56.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 202
AcoI YGGCCR 1 cut(s) 91
AfaI GTAC 1 cut(s) 210
AgsI TTSAA 2 cut(s) 21, 140
AoxI GGCC 1 cut(s) 91
ApeKI GCWGC 1 cut(s) 8
BfaI CTAG 1 cut(s) 161
BfmI CTRYAG 1 cut(s) 9
BisI GCNGC 2 cut(s) 9, 203
BlsI GCNGC 2 cut(s) 10, 204
BmsI GCATC 2 cut(s) 91, 153
BseGI GGATG 2 cut(s) 34, 144
BshFI GGCC 1 cut(s) 93
BsnI GGCC 1 cut(s) 93
Bsp1407I TGTACA 1 cut(s) 208
BspACI CCGC 1 cut(s) 202
BspANI GGCC 1 cut(s) 93
BspMAI CTGCAG 1 cut(s) 13
BsrGI TGTACA 1 cut(s) 208
BstAUI TGTACA 1 cut(s) 208
BstEII GGTNACC 1 cut(s) 164
BstF5I GGATG 2 cut(s) 34, 144
BstNSI RCATGY 1 cut(s) 209
BstPI GGTNACC 1 cut(s) 164
BstSFI CTRYAG 1 cut(s) 9
BsuRI GGCC 1 cut(s) 93
BtsCI GGATG 2 cut(s) 34, 144
Csp6I GTAC 1 cut(s) 209
CviAII CATG 1 cut(s) 206
CviJI RGCY 3 cut(s) 93, 124, 134
CviKI_1 RGCY 3 cut(s) 93, 124, 134
CviQI GTAC 1 cut(s) 209
EaeI YGGCCR 1 cut(s) 91
Eco91I GGTNACC 1 cut(s) 164
EcoO65I GGTNACC 1 cut(s) 164
FaeI CATG 1 cut(s) 209
FaiI YATR 7 cut(s) 107, 127, 129, 153, 155, 190, 207
FatI CATG 1 cut(s) 205
Fnu4HI GCNGC 2 cut(s) 9, 203
FokI GGATG 2 cut(s) 21, 131
Fsp4HI GCNGC 2 cut(s) 9, 203
FspBI CTAG 1 cut(s) 161
GluI GCNGC 2 cut(s) 9, 203
HaeIII GGCC 1 cut(s) 93
Hin1II CATG 1 cut(s) 209
HinfI GANTC 1 cut(s) 17
Hpy99I CGWCG 1 cut(s) 201
HpyCH4IV ACGT 1 cut(s) 196
HpyCH4V TGCA 2 cut(s) 11, 175
HpySE526I ACGT 1 cut(s) 196
Hsp92II CATG 1 cut(s) 209
LweI GCATC 2 cut(s) 91, 153
MaeI CTAG 1 cut(s) 161
MaeII ACGT 1 cut(s) 196
MaeIII GTNAC 1 cut(s) 164
MmeI TCCRAC 1 cut(s) 172
MnlI CCTC 3 cut(s) 19, 114, 124
NlaIII CATG 1 cut(s) 209
NmeAIII GCCGAG 1 cut(s) 119
NspI RCATGY 1 cut(s) 209
PfeI GAWTC 1 cut(s) 17
PkrI GCNGC 2 cut(s) 10, 204
PspEI GGTNACC 1 cut(s) 164
PstI CTGCAG 1 cut(s) 13
RsaI GTAC 1 cut(s) 210
RsaNI GTAC 1 cut(s) 209
SatI GCNGC 2 cut(s) 9, 203
SetI ASST 2 cut(s) 166, 199
SfaNI GCATC 2 cut(s) 91, 153
SfcI CTRYAG 1 cut(s) 9
SgeI CNNG 7 cut(s) 66, 68, 107, 173, 182, 195, 218
SsiI CCGC 1 cut(s) 202
SspMI CTAG 1 cut(s) 161
TaiI ACGT 1 cut(s) 199
TatI WGTACW 1 cut(s) 208
TauI GCSGC 1 cut(s) 205
TfiI GAWTC 1 cut(s) 17
TseI GCWGC 1 cut(s) 8
XceI RCATGY 1 cut(s) 209
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.