Rh3DG356300

Plant mobile domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0001683
Physical Location & Seq
Reverse (-)
43351372 .. 43351979
608 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG356300.1

Sequence Viewer

Length: 366 bp
ATGCAAGTACACGAGGTCACATGGGATCCATATCGTGGTCATAGGGATGCTCATCCATTATTGGAAATCACATTTTACACAGGAATGCTTAAGTGTTTAGATATTGTGGAACCATATTATCCTGATAGGGTTGTGTATGAGTACTTTGATGGATTGTGGCAAAGATGGCGAGATCACGTAGCAGATGCCAACCGAAGCACTCCAGTTAAGTTTTCATATGACCCTGATCGGGTGTCTGCTGCAGTTGATTCAAATGAGGAAAATCATCCATTACAGCGTATATCACGAGCATTGTATATCACTCAATCTATTGTTGATGTTGGCCGAGATGATGCTATAAGACAACCAATGAAGCTATATATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMD

Protein Analysis

121

Amino Acids

14.34

Weight (kDa)

5.42

Isoelectric Point (pI)

30.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 35
AclWI GGATC 2 cut(s) 20, 33
AcoI YGGCCR 1 cut(s) 322
AfaI GTAC 2 cut(s) 9, 143
AfiI CCNNNNNNNGG 2 cut(s) 35, 229
AflII CTTAAG 1 cut(s) 89
AgsI TTSAA 1 cut(s) 252
AluBI AGCT 1 cut(s) 355
AluI AGCT 1 cut(s) 355
AlwI GGATC 2 cut(s) 20, 33
AoxI GGCC 1 cut(s) 322
ApeKI GCWGC 1 cut(s) 239
BamHI GGATCC 1 cut(s) 25
BauI CACGAG 2 cut(s) 11, 285
BbvI GCAGC 1 cut(s) 226
BccI CCATC 2 cut(s) 143, 159
BfmI CTRYAG 1 cut(s) 240
BfrI CTTAAG 1 cut(s) 89
BisI GCNGC 1 cut(s) 240
BlsI GCNGC 1 cut(s) 241
BmcAI AGTACT 1 cut(s) 143
BmiI GGNNCC 2 cut(s) 27, 111
BmsI GCATC 3 cut(s) 37, 175, 322
BpmI CTGGAG 1 cut(s) 186
BsaAI YACGTR 1 cut(s) 178
BsaBI GATNNNNATC 2 cut(s) 30, 51
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 229
Bse1I ACTGG 1 cut(s) 203
Bse8I GATNNNNATC 2 cut(s) 30, 51
BseGI GGATG 3 cut(s) 52, 52, 265
BseJI GATNNNNATC 2 cut(s) 30, 51
BseLI CCNNNNNNNGG 2 cut(s) 35, 229
BseNI ACTGG 1 cut(s) 203
BseXI GCAGC 1 cut(s) 226
BshFI GGCC 1 cut(s) 324
BslI CCNNNNNNNGG 2 cut(s) 35, 229
BsmI GAATGC 1 cut(s) 90
BsnI GGCC 1 cut(s) 324
Bsp143I GATC 3 cut(s) 25, 172, 226
BspANI GGCC 1 cut(s) 324
BspLI GGNNCC 2 cut(s) 27, 111
BspMAI CTGCAG 1 cut(s) 244
BspPI GGATC 2 cut(s) 20, 33
BspTI CTTAAG 1 cut(s) 89
BsrI ACTGG 1 cut(s) 203
BssMI GATC 3 cut(s) 25, 172, 226
BssSI CACGAG 2 cut(s) 11, 285
Bst2BI CACGAG 2 cut(s) 11, 285
BstAFI CTTAAG 1 cut(s) 89
BstBAI YACGTR 1 cut(s) 178
BstF5I GGATG 3 cut(s) 52, 52, 265
BstKTI GATC 3 cut(s) 28, 175, 229
BstMBI GATC 3 cut(s) 25, 172, 226
BstMWI GCNNNNNNNGC 1 cut(s) 166
BstSFI CTRYAG 1 cut(s) 240
BstV1I GCAGC 1 cut(s) 226
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
BsuRI GGCC 1 cut(s) 324
BtsCI GGATG 3 cut(s) 52, 52, 265
Csp6I GTAC 2 cut(s) 8, 142
CviAII CATG 1 cut(s) 21
CviJI RGCY 2 cut(s) 324, 355
CviKI_1 RGCY 2 cut(s) 324, 355
CviQI GTAC 2 cut(s) 8, 142
DpnI GATC 3 cut(s) 27, 174, 228
DpnII GATC 3 cut(s) 25, 172, 226
EaeI YGGCCR 1 cut(s) 322
FaeI CATG 1 cut(s) 24
FatI CATG 1 cut(s) 20
FauNDI CATATG 1 cut(s) 217
Fnu4HI GCNGC 1 cut(s) 240
FokI GGATG 3 cut(s) 39, 59, 252
Fsp4HI GCNGC 1 cut(s) 240
GluI GCNGC 1 cut(s) 240
GsuI CTGGAG 1 cut(s) 186
HaeIII GGCC 1 cut(s) 324
Hin1II CATG 1 cut(s) 24
HinfI GANTC 1 cut(s) 248
Hpy166II GTNNAC 1 cut(s) 10
Hpy188III TCNNGA 2 cut(s) 122, 285
Hpy8I GTNNAC 1 cut(s) 10
HpyCH4IV ACGT 1 cut(s) 177
HpyCH4V TGCA 2 cut(s) 4, 242
HpyF10VI GCNNNNNNNGC 1 cut(s) 166
HpySE526I ACGT 1 cut(s) 177
Hsp92II CATG 1 cut(s) 24
Kzo9I GATC 3 cut(s) 25, 172, 226
LpnPI CCDG 4 cut(s) 66, 135, 216, 237
Lsp1109I GCAGC 1 cut(s) 226
LweI GCATC 3 cut(s) 37, 175, 322
MaeII ACGT 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 16
MalI GATC 3 cut(s) 27, 174, 228
MboI GATC 3 cut(s) 25, 172, 226
MflI RGATCY 1 cut(s) 25
MnlI CCTC 2 cut(s) 7, 250
MseI TTAA 2 cut(s) 90, 207
MslI CAYNNNNRTG 2 cut(s) 45, 83
MspCI CTTAAG 1 cut(s) 89
Mva1269I GAATGC 1 cut(s) 90
MwoI GCNNNNNNNGC 1 cut(s) 166
NdeI CATATG 1 cut(s) 217
NdeII GATC 3 cut(s) 25, 172, 226
NlaIII CATG 1 cut(s) 24
NlaIV GGNNCC 2 cut(s) 27, 111
NmeAIII GCCGAG 1 cut(s) 350
NmuCI GTSAC 1 cut(s) 16
PctI GAATGC 1 cut(s) 90
PfeI GAWTC 1 cut(s) 248
PflMI CCANNNNNTGG 1 cut(s) 35
PkrI GCNGC 1 cut(s) 241
Ppu21I YACGTR 1 cut(s) 178
PspN4I GGNNCC 2 cut(s) 27, 111
PstI CTGCAG 1 cut(s) 244
PsuI RGATCY 1 cut(s) 25
RsaI GTAC 2 cut(s) 9, 143
RsaNI GTAC 2 cut(s) 8, 142
RseI CAYNNNNRTG 2 cut(s) 45, 83
SaqAI TTAA 2 cut(s) 90, 207
SatI GCNGC 1 cut(s) 240
Sau3AI GATC 3 cut(s) 25, 172, 226
ScaI AGTACT 1 cut(s) 143
SetI ASST 3 cut(s) 18, 180, 357
SfaNI GCATC 3 cut(s) 37, 175, 322
SfcI CTRYAG 1 cut(s) 240
SmiMI CAYNNNNRTG 2 cut(s) 45, 83
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
TaiI ACGT 1 cut(s) 180
TatI WGTACW 2 cut(s) 7, 141
TfiI GAWTC 1 cut(s) 248
Tru1I TTAA 2 cut(s) 90, 207
Tru9I TTAA 2 cut(s) 90, 207
TseFI GTSAC 1 cut(s) 16
TseI GCWGC 1 cut(s) 239
Tsp45I GTSAC 1 cut(s) 16
TspDTI ATGAA 2 cut(s) 204, 365
Van91I CCANNNNNTGG 1 cut(s) 35
Vha464I CTTAAG 1 cut(s) 89
ZrmI AGTACT 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.