Rh2AG367300

Serine threonine-protein phosphatase 7 long form homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
54453705 .. 54454449
745 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG367300.1

Sequence Viewer

Length: 273 bp
ATGAACCCACATATGGCTAGAGGTCATAAACACCATGATTGCCCCACAACCTCAAAGACAAAAAGGAAATTTTGTTCTCAGCCTTCTCAGTTAGAAGTCGATGAGGGTGTTATAGATGATGGGGTTGATACTGCAGAAGAACAAGCTTGTGAACCATTTGCAGATGCAGATGAGCCTCTAAGTGGTCCATTTCCTGGTGGTCCTCATGATCCATCGGTATTGAAGAGCTTTAAAAGTCATGTAGCAGCTGCCATATGGTTTAATAAGGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

9.81

Weight (kDa)

5.56

Isoelectric Point (pI)

43.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 194
AclWI GGATC 1 cut(s) 203
AcsI RAATTY 1 cut(s) 68
AfiI CCNNNNNNNGG 3 cut(s) 13, 182, 194
AgsI TTSAA 1 cut(s) 223
AjnI CCWGG 1 cut(s) 193
AloI GAACNNNNNNTCC 2 cut(s) 58, 90
AluBI AGCT 3 cut(s) 146, 228, 248
AluI AGCT 3 cut(s) 146, 228, 248
AlwI GGATC 1 cut(s) 203
ApeKI GCWGC 2 cut(s) 245, 248
ApoI RAATTY 1 cut(s) 68
AspS9I GGNCC 2 cut(s) 185, 200
AvaII GGWCC 2 cut(s) 185, 200
BbvI GCAGC 2 cut(s) 235, 257
BccI CCATC 2 cut(s) 113, 220
BciT130I CCWGG 1 cut(s) 195
BfaI CTAG 1 cut(s) 18
BfmI CTRYAG 1 cut(s) 132
BisI GCNGC 2 cut(s) 246, 249
BlsI GCNGC 2 cut(s) 247, 250
Bme1390I CCNGG 1 cut(s) 195
Bme18I GGWCC 2 cut(s) 185, 200
BmgT120I GGNCC 2 cut(s) 185, 200
BmrFI CCNGG 1 cut(s) 195
BmsI GCATC 1 cut(s) 154
Bsc4I CCNNNNNNNGG 3 cut(s) 13, 182, 194
BseBI CCWGG 1 cut(s) 195
BseLI CCNNNNNNNGG 3 cut(s) 13, 182, 194
BseMII CTCAG 2 cut(s) 92, 101
BseXI GCAGC 2 cut(s) 235, 257
BslI CCNNNNNNNGG 3 cut(s) 13, 182, 194
Bsp143I GATC 1 cut(s) 208
BspCNI CTCAG 2 cut(s) 91, 100
BspHI TCATGA 1 cut(s) 205
BspMAI CTGCAG 1 cut(s) 136
BspPI GGATC 1 cut(s) 203
BspQI GCTCTTC 1 cut(s) 218
BssMI GATC 1 cut(s) 208
Bst2UI CCWGG 1 cut(s) 195
Bst6I CTCTTC 1 cut(s) 218
BstDEI CTNAG 3 cut(s) 78, 87, 179
BstKTI GATC 1 cut(s) 211
BstMBI GATC 1 cut(s) 208
BstNI CCWGG 1 cut(s) 195
BstSCI CCNGG 1 cut(s) 193
BstSFI CTRYAG 1 cut(s) 132
BstV1I GCAGC 2 cut(s) 235, 257
CciI TCATGA 1 cut(s) 205
Cfr13I GGNCC 2 cut(s) 185, 200
CviAII CATG 3 cut(s) 35, 206, 239
CviJI RGCY 6 cut(s) 17, 82, 146, 175, 228, 248
CviKI_1 RGCY 6 cut(s) 17, 82, 146, 175, 228, 248
DdeI CTNAG 3 cut(s) 78, 87, 179
DpnI GATC 1 cut(s) 210
DpnII GATC 1 cut(s) 208
DraI TTTAAA 1 cut(s) 232
Eam1104I CTCTTC 1 cut(s) 218
EarI CTCTTC 1 cut(s) 218
Eco47I GGWCC 2 cut(s) 185, 200
EcoRII CCWGG 1 cut(s) 193
FaeI CATG 3 cut(s) 38, 209, 242
FatI CATG 3 cut(s) 34, 205, 238
FauNDI CATATG 2 cut(s) 12, 254
Fnu4HI GCNGC 2 cut(s) 246, 249
Fsp4HI GCNGC 2 cut(s) 246, 249
FspBI CTAG 1 cut(s) 18
GluI GCNGC 2 cut(s) 246, 249
Hin1II CATG 3 cut(s) 38, 209, 242
HindIII AAGCTT 1 cut(s) 144
Hpy166II GTNNAC 1 cut(s) 152
Hpy188III TCNNGA 1 cut(s) 206
Hpy8I GTNNAC 1 cut(s) 152
HpyAV CCTTC 1 cut(s) 93
HpyCH4V TGCA 3 cut(s) 134, 161, 167
HpyF3I CTNAG 3 cut(s) 78, 87, 179
Hsp92II CATG 3 cut(s) 38, 209, 242
Kzo9I GATC 1 cut(s) 208
LguI GCTCTTC 1 cut(s) 218
LpnPI CCDG 2 cut(s) 180, 207
Lsp1109I GCAGC 2 cut(s) 235, 257
LweI GCATC 1 cut(s) 154
MaeI CTAG 1 cut(s) 18
MalI GATC 1 cut(s) 210
MboI GATC 1 cut(s) 208
MboII GAAGA 2 cut(s) 149, 235
MluCI AATT 1 cut(s) 68
MnlI CCTC 5 cut(s) 14, 61, 97, 186, 213
MseI TTAA 2 cut(s) 231, 261
MspA1I CMGCKG 1 cut(s) 248
MspR9I CCNGG 1 cut(s) 195
MvaI CCWGG 1 cut(s) 195
NdeI CATATG 2 cut(s) 12, 254
NdeII GATC 1 cut(s) 208
NlaIII CATG 3 cut(s) 38, 209, 242
PagI TCATGA 1 cut(s) 205
PciSI GCTCTTC 1 cut(s) 218
PflMI CCANNNNNTGG 1 cut(s) 194
PkrI GCNGC 2 cut(s) 247, 250
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
PspPI GGNCC 2 cut(s) 185, 200
PstI CTGCAG 1 cut(s) 136
PvuII CAGCTG 1 cut(s) 248
SapI GCTCTTC 1 cut(s) 218
SaqAI TTAA 2 cut(s) 231, 261
SatI GCNGC 2 cut(s) 246, 249
Sau3AI GATC 1 cut(s) 208
Sau96I GGNCC 2 cut(s) 185, 200
ScrFI CCNGG 1 cut(s) 195
SetI ASST 6 cut(s) 25, 53, 148, 230, 250, 270
SfaNI GCATC 1 cut(s) 154
SfcI CTRYAG 1 cut(s) 132
SgeI CNNG 8 cut(s) 30, 47, 155, 159, 206, 207, 218, 251
SinI GGWCC 2 cut(s) 185, 200
Sse9I AATT 1 cut(s) 68
SspMI CTAG 1 cut(s) 18
StyD4I CCNGG 1 cut(s) 193
TaqI TCGA 1 cut(s) 99
TasI AATT 1 cut(s) 68
Tru1I TTAA 2 cut(s) 231, 261
Tru9I TTAA 2 cut(s) 231, 261
TseI GCWGC 2 cut(s) 245, 248
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 194
VpaK11BI GGWCC 2 cut(s) 185, 200
XapI RAATTY 1 cut(s) 68
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.