Rh5BG277000

Serine threonine-protein phosphatase 7 long form homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
34916609 .. 34920423
3815 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG277000.1

Sequence Viewer

Length: 261 bp
ATGGCTAGAGGTCATAAACACCATGATTGCCCCACAACCTCAAAGACAAAAAGGAAATTTTGTTCTCAACCTTCTCAGTCAGAAGTAGATGAGGGTGTTATAGATGATGGGGTTGATACTGCAGAAGAACAAGCTTGTGAACCATTTGCAGATGTAGATGAGCCTCTAAGTGGTCCATTTCCTGGTGGTCCTCATGATCCATCGGTATTGAAGAGCTTTAAAAGTCATGTAGCAGCTGCCATATGGTTTAATAAGGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.33

Weight (kDa)

5.37

Isoelectric Point (pI)

52.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 182
AclWI GGATC 1 cut(s) 191
AcsI RAATTY 1 cut(s) 56
AfiI CCNNNNNNNGG 2 cut(s) 170, 182
AgsI TTSAA 1 cut(s) 211
AjnI CCWGG 1 cut(s) 181
AloI GAACNNNNNNTCC 2 cut(s) 46, 78
AluBI AGCT 3 cut(s) 134, 216, 236
AluI AGCT 3 cut(s) 134, 216, 236
AlwI GGATC 1 cut(s) 191
ApeKI GCWGC 2 cut(s) 233, 236
ApoI RAATTY 1 cut(s) 56
AspS9I GGNCC 2 cut(s) 173, 188
AvaII GGWCC 2 cut(s) 173, 188
BbvI GCAGC 2 cut(s) 223, 245
BccI CCATC 2 cut(s) 101, 208
BciT130I CCWGG 1 cut(s) 183
BfaI CTAG 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 120
BisI GCNGC 2 cut(s) 234, 237
BlsI GCNGC 2 cut(s) 235, 238
Bme1390I CCNGG 1 cut(s) 183
Bme18I GGWCC 2 cut(s) 173, 188
BmgT120I GGNCC 2 cut(s) 173, 188
BmrFI CCNGG 1 cut(s) 183
Bsc4I CCNNNNNNNGG 2 cut(s) 170, 182
BseBI CCWGG 1 cut(s) 183
BseLI CCNNNNNNNGG 2 cut(s) 170, 182
BseMII CTCAG 1 cut(s) 89
BseXI GCAGC 2 cut(s) 223, 245
BslI CCNNNNNNNGG 2 cut(s) 170, 182
Bsp143I GATC 1 cut(s) 196
BspCNI CTCAG 1 cut(s) 88
BspHI TCATGA 1 cut(s) 193
BspMAI CTGCAG 1 cut(s) 124
BspPI GGATC 1 cut(s) 191
BspQI GCTCTTC 1 cut(s) 206
BssMI GATC 1 cut(s) 196
Bst2UI CCWGG 1 cut(s) 183
Bst6I CTCTTC 1 cut(s) 206
BstDEI CTNAG 2 cut(s) 75, 167
BstKTI GATC 1 cut(s) 199
BstMBI GATC 1 cut(s) 196
BstNI CCWGG 1 cut(s) 183
BstSCI CCNGG 1 cut(s) 181
BstSFI CTRYAG 1 cut(s) 120
BstV1I GCAGC 2 cut(s) 223, 245
CciI TCATGA 1 cut(s) 193
Cfr13I GGNCC 2 cut(s) 173, 188
CviAII CATG 3 cut(s) 23, 194, 227
CviJI RGCY 5 cut(s) 5, 134, 163, 216, 236
CviKI_1 RGCY 5 cut(s) 5, 134, 163, 216, 236
DdeI CTNAG 2 cut(s) 75, 167
DpnI GATC 1 cut(s) 198
DpnII GATC 1 cut(s) 196
DraI TTTAAA 1 cut(s) 220
Eam1104I CTCTTC 1 cut(s) 206
EarI CTCTTC 1 cut(s) 206
Eco47I GGWCC 2 cut(s) 173, 188
EcoRII CCWGG 1 cut(s) 181
FaeI CATG 3 cut(s) 26, 197, 230
FaiI YATR 8 cut(s) 15, 24, 101, 195, 228, 242, 244, 259
FatI CATG 3 cut(s) 22, 193, 226
FauNDI CATATG 1 cut(s) 242
Fnu4HI GCNGC 2 cut(s) 234, 237
Fsp4HI GCNGC 2 cut(s) 234, 237
FspBI CTAG 1 cut(s) 6
GluI GCNGC 2 cut(s) 234, 237
Hin1II CATG 3 cut(s) 26, 197, 230
HindIII AAGCTT 1 cut(s) 132
Hpy166II GTNNAC 1 cut(s) 140
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 194
Hpy8I GTNNAC 1 cut(s) 140
HpyAV CCTTC 1 cut(s) 81
HpyCH4V TGCA 2 cut(s) 122, 149
HpyF3I CTNAG 2 cut(s) 75, 167
Hsp92II CATG 3 cut(s) 26, 197, 230
Kzo9I GATC 1 cut(s) 196
LguI GCTCTTC 1 cut(s) 206
LpnPI CCDG 2 cut(s) 168, 195
Lsp1109I GCAGC 2 cut(s) 223, 245
MaeI CTAG 1 cut(s) 6
MalI GATC 1 cut(s) 198
MboI GATC 1 cut(s) 196
MboII GAAGA 2 cut(s) 137, 223
MluCI AATT 1 cut(s) 56
MnlI CCTC 4 cut(s) 49, 85, 174, 201
MseI TTAA 2 cut(s) 219, 249
MspA1I CMGCKG 1 cut(s) 236
MspR9I CCNGG 1 cut(s) 183
MvaI CCWGG 1 cut(s) 183
NdeI CATATG 1 cut(s) 242
NdeII GATC 1 cut(s) 196
NlaIII CATG 3 cut(s) 26, 197, 230
PagI TCATGA 1 cut(s) 193
PciSI GCTCTTC 1 cut(s) 206
PflMI CCANNNNNTGG 1 cut(s) 182
PkrI GCNGC 2 cut(s) 235, 238
Psp6I CCWGG 1 cut(s) 181
PspGI CCWGG 1 cut(s) 181
PspPI GGNCC 2 cut(s) 173, 188
PstI CTGCAG 1 cut(s) 124
PvuII CAGCTG 1 cut(s) 236
SapI GCTCTTC 1 cut(s) 206
SaqAI TTAA 2 cut(s) 219, 249
SatI GCNGC 2 cut(s) 234, 237
Sau3AI GATC 1 cut(s) 196
Sau96I GGNCC 2 cut(s) 173, 188
ScrFI CCNGG 1 cut(s) 183
SetI ASST 7 cut(s) 13, 41, 73, 136, 218, 238, 258
SfcI CTRYAG 1 cut(s) 120
SgeI CNNG 8 cut(s) 18, 35, 143, 147, 194, 195, 206, 239
SinI GGWCC 2 cut(s) 173, 188
Sse9I AATT 1 cut(s) 56
SspMI CTAG 1 cut(s) 6
StyD4I CCNGG 1 cut(s) 181
TasI AATT 1 cut(s) 56
Tru1I TTAA 2 cut(s) 219, 249
Tru9I TTAA 2 cut(s) 219, 249
TseI GCWGC 2 cut(s) 233, 236
Van91I CCANNNNNTGG 1 cut(s) 182
VpaK11BI GGWCC 2 cut(s) 173, 188
XapI RAATTY 1 cut(s) 56
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.