RLG00000032867

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
20169711 .. 20171220
1510 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000032867

Sequence Viewer

Length: 318 bp
ATGGCACTCCATGAGCATTCCGAACTACTTATCAGTCACCAACCAATGATCTCTTTTCTGTCAGTAATATGGAAGAAAGAACTTCAGGAAACGACGAACAAGAGAAGACAAAGATTTGTTACTTGCTCAAGAACTTGGATAGTTGATGATAAAATGGCCATCAAACCTCAGGAGGTTATCGTTTGGAACAGACAGCTACAAAAGCGTATGATAGAACAAAACTTATTCACGGGAGCACACAAGAATACGTTACTCACTGAGAAGGATAATTTAAATCAAGTCCAACTCAGAGTATCCAGCTTCCGTGTTGAATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

12.59

Weight (kDa)

9.8

Isoelectric Point (pI)

49.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 156
AcsI RAATTY 1 cut(s) 311
AcuI CTGAAG 1 cut(s) 68
AgsI TTSAA 1 cut(s) 311
AluBI AGCT 2 cut(s) 196, 300
AluI AGCT 2 cut(s) 196, 300
Alw21I GWGCWC 1 cut(s) 238
AoxI GGCC 1 cut(s) 156
ApoI RAATTY 1 cut(s) 311
AsuHPI GGTGA 1 cut(s) 29
AxyI CCTNAGG 1 cut(s) 168
BalI TGGCCA 1 cut(s) 158
BbsI GAAGAC 1 cut(s) 112
Bbv12I GWGCWC 1 cut(s) 238
BccI CCATC 1 cut(s) 167
BciVI GTATCC 1 cut(s) 304
BfuI GTATCC 1 cut(s) 304
BpiI GAAGAC 1 cut(s) 112
BpuEI CTTGAG 1 cut(s) 112
Bse21I CCTNAGG 1 cut(s) 168
BseMII CTCAG 3 cut(s) 182, 249, 301
BshFI GGCC 1 cut(s) 158
BsiHKAI GWGCWC 1 cut(s) 238
BsmI GAATGC 1 cut(s) 16
BsnI GGCC 1 cut(s) 158
Bsp1286I GDGCHC 1 cut(s) 238
Bsp143I GATC 1 cut(s) 48
BspANI GGCC 1 cut(s) 158
BspCNI CTCAG 3 cut(s) 181, 250, 300
BssMI GATC 1 cut(s) 48
BstDEI CTNAG 3 cut(s) 168, 258, 287
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstMWI GCNNNNNNNGC 1 cut(s) 202
BstV2I GAAGAC 1 cut(s) 112
Bsu36I CCTNAGG 1 cut(s) 168
BsuI GTATCC 1 cut(s) 304
BsuRI GGCC 1 cut(s) 158
BtsIMutI CAGTG 1 cut(s) 255
CviAII CATG 1 cut(s) 11
CviJI RGCY 3 cut(s) 158, 196, 300
CviKI_1 RGCY 3 cut(s) 158, 196, 300
DdeI CTNAG 3 cut(s) 168, 258, 287
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
DraI TTTAAA 1 cut(s) 273
EaeI YGGCCR 1 cut(s) 156
Eco57I CTGAAG 1 cut(s) 68
Eco81I CCTNAGG 1 cut(s) 168
FaeI CATG 1 cut(s) 14
FaiI YATR 3 cut(s) 12, 70, 209
FatI CATG 1 cut(s) 10
HaeIII GGCC 1 cut(s) 158
Hin1II CATG 1 cut(s) 14
HphI GGTGA 1 cut(s) 29
Hpy188I TCNGA 2 cut(s) 22, 290
Hpy188III TCNNGA 3 cut(s) 86, 129, 170
Hpy99I CGWCG 1 cut(s) 97
HpyAV CCTTC 1 cut(s) 256
HpyCH4IV ACGT 1 cut(s) 248
HpyF10VI GCNNNNNNNGC 1 cut(s) 202
HpyF3I CTNAG 3 cut(s) 168, 258, 287
HpySE526I ACGT 1 cut(s) 248
Hsp92II CATG 1 cut(s) 14
Kzo9I GATC 1 cut(s) 48
LmnI GCTCC 1 cut(s) 233
LpnPI CCDG 3 cut(s) 71, 155, 310
MaeII ACGT 1 cut(s) 248
MaeIII GTNAC 3 cut(s) 35, 118, 249
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MboII GAAGA 2 cut(s) 85, 117
MhlI GDGCHC 1 cut(s) 238
MlsI TGGCCA 1 cut(s) 158
MluCI AATT 2 cut(s) 268, 311
MluNI TGGCCA 1 cut(s) 158
MmeI TCCRAC 1 cut(s) 307
MnlI CCTC 2 cut(s) 166, 177
Mox20I TGGCCA 1 cut(s) 158
MscI TGGCCA 1 cut(s) 158
MseI TTAA 1 cut(s) 272
Msp20I TGGCCA 1 cut(s) 158
Mva1269I GAATGC 1 cut(s) 16
MwoI GCNNNNNNNGC 1 cut(s) 202
NdeII GATC 1 cut(s) 48
NlaIII CATG 1 cut(s) 14
NmuCI GTSAC 1 cut(s) 35
PctI GAATGC 1 cut(s) 16
SaqAI TTAA 1 cut(s) 272
Sau3AI GATC 1 cut(s) 48
SduI GDGCHC 1 cut(s) 238
SetI ASST 5 cut(s) 169, 177, 198, 251, 302
SmiI ATTTAAAT 1 cut(s) 273
SmlI CTYRAG 1 cut(s) 127
SmoI CTYRAG 1 cut(s) 127
Sse9I AATT 2 cut(s) 268, 311
SwaI ATTTAAAT 1 cut(s) 273
TaiI ACGT 1 cut(s) 251
TasI AATT 2 cut(s) 268, 311
Tru1I TTAA 1 cut(s) 272
Tru9I TTAA 1 cut(s) 272
TscAI CASTG 1 cut(s) 262
TseFI GTSAC 1 cut(s) 35
Tsp45I GTSAC 1 cut(s) 35
TspGWI ACGGA 1 cut(s) 293
TspRI CASTG 1 cut(s) 262
XapI RAATTY 1 cut(s) 311
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.