Rh2CG303700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0002681
Physical Location & Seq
Reverse (-)
35680310 .. 35680603
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG303700.1

Sequence Viewer

Length: 294 bp
ATGGACCTGCTTTCCATGCCTGGCCAATCGGACCTCTGTGCCCCTACGACGCCATTTGATTTGATTCTCAGATCCCTCACCAGTTGGGGATTTGACAATCCAGATTTGTCTTTTTGTATTTGTTGTGATCTTGGTCCGAATTGGTTATGGCGGAGGTCGGGTAATCGATCCAGATTTGGATTGATGCTGTTTGATGTTTCCCTGGCTGTGAGGATCGGAGTTAGGGCCTTGATTGGTAGTGGGATTCGCTGTGACGTCTCTTTTTCTGGAAGATCGATGCGACGACTTCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.87

Weight (kDa)

9.17

Isoelectric Point (pI)

66.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 258
Acc36I ACCTGC 1 cut(s) 15
AciI CCGC 1 cut(s) 151
AclWI GGATC 3 cut(s) 66, 162, 221
AcoI YGGCCR 1 cut(s) 22
AcyI GRCGYC 2 cut(s) 50, 255
AjnI CCWGG 2 cut(s) 19, 201
Alw26I GTCTC 1 cut(s) 262
AlwI GGATC 3 cut(s) 66, 162, 221
AoxI GGCC 2 cut(s) 22, 225
AspS9I GGNCC 4 cut(s) 4, 31, 134, 225
AsuHPI GGTGA 1 cut(s) 70
AvaII GGWCC 3 cut(s) 4, 31, 134
BaeGI GKGCMC 1 cut(s) 43
BalI TGGCCA 1 cut(s) 24
BciT130I CCWGG 2 cut(s) 21, 203
BcoDI GTCTC 1 cut(s) 262
BfuAI ACCTGC 1 cut(s) 15
Bme1390I CCNGG 2 cut(s) 21, 203
Bme18I GGWCC 3 cut(s) 4, 31, 134
BmgT120I GGNCC 4 cut(s) 4, 31, 134, 225
BmrFI CCNGG 2 cut(s) 21, 203
BmsI GCATC 2 cut(s) 174, 267
Bsa29I ATCGAT 2 cut(s) 166, 275
BsaHI GRCGYC 2 cut(s) 50, 255
BsaJI CCNNGG 1 cut(s) 201
BsaXI ACNNNNNCTCC 2 cut(s) 145, 175
Bse1I ACTGG 1 cut(s) 81
BseBI CCWGG 2 cut(s) 21, 203
BseCI ATCGAT 2 cut(s) 166, 275
BseDI CCNNGG 1 cut(s) 201
BseMII CTCAG 1 cut(s) 82
BseNI ACTGG 1 cut(s) 81
BseSI GKGCMC 1 cut(s) 43
BshFI GGCC 2 cut(s) 24, 227
BshVI ATCGAT 2 cut(s) 166, 275
BsmAI GTCTC 1 cut(s) 262
BsmBI CGTCTC 1 cut(s) 262
BsnI GGCC 2 cut(s) 24, 227
Bsp1286I GDGCHC 1 cut(s) 43
Bsp143I GATC 5 cut(s) 71, 127, 167, 213, 272
BspACI CCGC 1 cut(s) 151
BspANI GGCC 2 cut(s) 24, 227
BspCNI CTCAG 1 cut(s) 81
BspDI ATCGAT 2 cut(s) 166, 275
BspMI ACCTGC 1 cut(s) 15
BspPI GGATC 3 cut(s) 66, 162, 221
BsrI ACTGG 1 cut(s) 81
BssECI CCNNGG 1 cut(s) 201
BssMI GATC 5 cut(s) 71, 127, 167, 213, 272
BssNI GRCGYC 2 cut(s) 50, 255
Bst2UI CCWGG 2 cut(s) 21, 203
BstACI GRCGYC 2 cut(s) 50, 255
BstDEI CTNAG 1 cut(s) 68
BstKTI GATC 5 cut(s) 74, 130, 170, 216, 275
BstMAI GTCTC 1 cut(s) 262
BstMBI GATC 5 cut(s) 71, 127, 167, 213, 272
BstMWI GCNNNNNNNGC 1 cut(s) 16
BstNI CCWGG 2 cut(s) 21, 203
BstSCI CCNGG 2 cut(s) 19, 201
BstSLI GKGCMC 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 71
BstYI RGATCY 1 cut(s) 71
Bsu15I ATCGAT 2 cut(s) 166, 275
BsuRI GGCC 2 cut(s) 24, 227
BsuTUI ATCGAT 2 cut(s) 166, 275
BveI ACCTGC 1 cut(s) 15
Cfr13I GGNCC 4 cut(s) 4, 31, 134, 225
ClaI ATCGAT 2 cut(s) 166, 275
CseI GACGC 1 cut(s) 58
CviAII CATG 1 cut(s) 16
CviJI RGCY 3 cut(s) 24, 206, 227
CviKI_1 RGCY 3 cut(s) 24, 206, 227
DdeI CTNAG 1 cut(s) 68
DpnI GATC 5 cut(s) 73, 129, 169, 215, 274
DpnII GATC 5 cut(s) 71, 127, 167, 213, 272
EaeI YGGCCR 1 cut(s) 22
EciI GGCGGA 1 cut(s) 166
Eco47I GGWCC 3 cut(s) 4, 31, 134
EcoO109I RGGNCCY 1 cut(s) 225
EcoRII CCWGG 2 cut(s) 19, 201
Esp3I CGTCTC 1 cut(s) 262
FaeI CATG 1 cut(s) 19
FaiI YATR 2 cut(s) 17, 148
FatI CATG 1 cut(s) 15
HaeIII GGCC 2 cut(s) 24, 227
HgaI GACGC 1 cut(s) 58
Hin1I GRCGYC 2 cut(s) 50, 255
Hin1II CATG 1 cut(s) 19
HinfI GANTC 2 cut(s) 64, 244
HphI GGTGA 1 cut(s) 70
Hpy188I TCNGA 4 cut(s) 31, 71, 138, 218
Hpy188III TCNNGA 3 cut(s) 101, 171, 267
Hpy99I CGWCG 2 cut(s) 52, 285
HpyCH4IV ACGT 1 cut(s) 255
HpyF10VI GCNNNNNNNGC 1 cut(s) 16
HpyF3I CTNAG 1 cut(s) 68
HpySE526I ACGT 1 cut(s) 255
Hsp92I GRCGYC 2 cut(s) 50, 255
Hsp92II CATG 1 cut(s) 19
Kzo9I GATC 5 cut(s) 71, 127, 167, 213, 272
LpnPI CCDG 9 cut(s) 6, 20, 33, 94, 114, 184, 188, 215, 252
LweI GCATC 2 cut(s) 174, 267
MaeII ACGT 1 cut(s) 255
MaeIII GTNAC 1 cut(s) 251
MalI GATC 5 cut(s) 73, 129, 169, 215, 274
MboI GATC 5 cut(s) 71, 127, 167, 213, 272
MboII GAAGA 1 cut(s) 282
MflI RGATCY 1 cut(s) 71
MhlI GDGCHC 1 cut(s) 43
MlsI TGGCCA 1 cut(s) 24
MluCI AATT 1 cut(s) 139
MluNI TGGCCA 1 cut(s) 24
MnlI CCTC 4 cut(s) 44, 86, 147, 204
Mox20I TGGCCA 1 cut(s) 24
MscI TGGCCA 1 cut(s) 24
Msp20I TGGCCA 1 cut(s) 24
MspR9I CCNGG 2 cut(s) 21, 203
MvaI CCWGG 2 cut(s) 21, 203
MwoI GCNNNNNNNGC 1 cut(s) 16
NdeII GATC 5 cut(s) 71, 127, 167, 213, 272
NlaIII CATG 1 cut(s) 19
NmuCI GTSAC 1 cut(s) 251
PfeI GAWTC 2 cut(s) 64, 244
Psp6I CCWGG 2 cut(s) 19, 201
PspGI CCWGG 2 cut(s) 19, 201
PspPI GGNCC 4 cut(s) 4, 31, 134, 225
PsuI RGATCY 1 cut(s) 71
Sau3AI GATC 5 cut(s) 71, 127, 167, 213, 272
Sau96I GGNCC 4 cut(s) 4, 31, 134, 225
ScrFI CCNGG 2 cut(s) 21, 203
SduI GDGCHC 1 cut(s) 43
SetI ASST 4 cut(s) 9, 36, 158, 258
SfaNI GCATC 2 cut(s) 174, 267
SinI GGWCC 3 cut(s) 4, 31, 134
Sse9I AATT 1 cut(s) 139
SsiI CCGC 1 cut(s) 151
StyD4I CCNGG 2 cut(s) 19, 201
TaiI ACGT 1 cut(s) 258
TaqI TCGA 2 cut(s) 166, 275
TasI AATT 1 cut(s) 139
TfiI GAWTC 2 cut(s) 64, 244
TseFI GTSAC 1 cut(s) 251
Tsp45I GTSAC 1 cut(s) 251
VpaK11BI GGWCC 3 cut(s) 4, 31, 134
ZraI GACGTC 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.