Rmu_co8062644.1_g000001

Rae1-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8062644.1
Physical Location & Seq
Reverse (-)
1 .. 351
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8062644.1_g000001.1.cds

Sequence Viewer

Length: 150 bp
atgcaaaggtgcagtcagcctataccttgcagtacctttaaccacgatggttccatatatgcatatgcggtttgctacgattggagcaagggtgcagaaaatcataatcctgcggcagcaaagaaccacattttcctccatttgccacag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.63

Weight (kDa)

6.88

Isoelectric Point (pI)

51.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 68, 113
AfaI GTAC 1 cut(s) 34
ApeKI GCWGC 1 cut(s) 116
ArsI GACNNNNNNTTYG 1 cut(s) 30
BbvI GCAGC 1 cut(s) 128
BccI CCATC 1 cut(s) 41
BisI GCNGC 2 cut(s) 114, 117
BlsI GCNGC 2 cut(s) 115, 118
BmiI GGNNCC 1 cut(s) 52
BsaXI ACNNNNNCTCC 2 cut(s) 76, 106
BseXI GCAGC 1 cut(s) 128
BsgI GTGCAG 2 cut(s) 31, 114
BspACI CCGC 2 cut(s) 68, 113
BspLI GGNNCC 1 cut(s) 52
BstV1I GCAGC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 33
CviJI RGCY 1 cut(s) 19
CviKI_1 RGCY 1 cut(s) 19
CviQI GTAC 1 cut(s) 33
EcoT22I ATGCAT 1 cut(s) 64
FaiI YATR 7 cut(s) 23, 56, 58, 60, 64, 66, 105
FauNDI CATATG 1 cut(s) 64
Fnu4HI GCNGC 2 cut(s) 114, 117
Fsp4HI GCNGC 2 cut(s) 114, 117
GluI GCNGC 2 cut(s) 114, 117
HpyCH4V TGCA 5 cut(s) 4, 12, 30, 62, 95
LmnI GCTCC 1 cut(s) 84
LpnPI CCDG 1 cut(s) 123
Lsp1109I GCAGC 1 cut(s) 128
MnlI CCTC 1 cut(s) 146
Mph1103I ATGCAT 1 cut(s) 64
MseI TTAA 1 cut(s) 39
NdeI CATATG 1 cut(s) 64
NlaIV GGNNCC 1 cut(s) 52
NsiI ATGCAT 1 cut(s) 64
PkrI GCNGC 2 cut(s) 115, 118
PspN4I GGNNCC 1 cut(s) 52
RsaI GTAC 1 cut(s) 34
RsaNI GTAC 1 cut(s) 33
SaqAI TTAA 1 cut(s) 39
SatI GCNGC 2 cut(s) 114, 117
SetI ASST 3 cut(s) 11, 28, 38
SgeI CNNG 4 cut(s) 39, 56, 100, 122
SsiI CCGC 2 cut(s) 68, 113
TauI GCSGC 1 cut(s) 116
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TseI GCWGC 1 cut(s) 116
Zsp2I ATGCAT 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.