Rmu_co8466619.1_g000001

26S proteasome non-ATPase regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8466619.1
Physical Location & Seq
Reverse (-)
2 .. 1856
1855 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8466619.1_g000001.1.cds

Sequence Viewer

Length: 607 bp
ctgaggattcgagctgcattggttaagttgagtagctgcgatgggttgttgttagtttcgtccgatgaagatttggccttgaagcaacaattggagttatatgtggagagggttcaagatcccgatcccgggttgcagaaggttgcccttgagagtatgaggcaggaaattcgtacctcaactagttccatgacctcagttccaaagccgttaaaatatcttcgcccacattatggaactctaaaagcatattatgaaacaatgagtgattcggatttgaggaaatacctcgcagatatattgtcggttttggcattgaccatgtctgctgaaggagaacgggaaagcttaaagtttagattattgggttcagatggtgatattggttcatggggccatgaatatgtcaggaacttagctggagaaattgctcaagaatatgccaagcgacagagtgatgagaccccctttgatgatctaatggaactagtacaacaaatagttgcttttcacatgaggcacaatgccgaaccggaagctgttgaccttttaatggaggtggaagaccttgatctgttagttgagcatgttgataagacaaatttta

Protein Analysis

202

Amino Acids

22.92

Weight (kDa)

4.75

Isoelectric Point (pI)

44.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 233
AclWI GGATC 2 cut(s) 113, 119
AcsI RAATTY 2 cut(s) 168, 601
AcuI CTGAAG 1 cut(s) 351
AfaI GTAC 2 cut(s) 175, 492
AfiI CCNNNNNNNGG 4 cut(s) 128, 129, 233, 553
AgsI TTSAA 2 cut(s) 82, 116
AhlI ACTAGT 2 cut(s) 182, 487
AjuI GAANNNNNNNTTGG 2 cut(s) 74, 106
AluBI AGCT 5 cut(s) 14, 36, 348, 419, 539
AluI AGCT 5 cut(s) 14, 36, 348, 419, 539
Alw26I GTCTC 1 cut(s) 455
AlwI GGATC 2 cut(s) 113, 119
Ama87I CYCGRG 1 cut(s) 128
AoxI GGCC 2 cut(s) 75, 394
ApeKI GCWGC 2 cut(s) 14, 36
ApoI RAATTY 2 cut(s) 168, 601
AspS9I GGNCC 1 cut(s) 394
AsuC2I CCSGG 2 cut(s) 129, 130
AsuHPI GGTGA 1 cut(s) 389
AvaI CYCGRG 1 cut(s) 128
BbsI GAAGAC 1 cut(s) 570
BbvI GCAGC 1 cut(s) 23
BccI CCATC 2 cut(s) 35, 368
BceAI ACGGC 1 cut(s) 193
BcgI CGANNNNNNTGC 2 cut(s) 152, 186
BcnI CCSGG 2 cut(s) 129, 130
BcoDI GTCTC 1 cut(s) 455
BcuI ACTAGT 2 cut(s) 182, 487
BfaI CTAG 2 cut(s) 183, 488
BisI GCNGC 2 cut(s) 15, 37
BlsI GCNGC 2 cut(s) 16, 38
Bme1390I CCNGG 2 cut(s) 129, 130
BmeT110I CYCGRG 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 394
BmiI GGNNCC 1 cut(s) 395
BmrFI CCNGG 2 cut(s) 129, 130
BpiI GAAGAC 1 cut(s) 570
BpmI CTGGAG 1 cut(s) 441
BpuEI CTTGAG 2 cut(s) 170, 417
BpuMI CCSGG 2 cut(s) 129, 130
BsaBI GATNNNNATC 1 cut(s) 123
BsaI GGTCTC 1 cut(s) 455
BsaJI CCNNGG 1 cut(s) 128
BsaWI WCCGGW 1 cut(s) 532
Bsc4I CCNNNNNNNGG 4 cut(s) 128, 129, 233, 553
Bse8I GATNNNNATC 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 128
BseJI GATNNNNATC 1 cut(s) 123
BseLI CCNNNNNNNGG 4 cut(s) 128, 129, 233, 553
BseMII CTCAG 1 cut(s) 210
BseXI GCAGC 1 cut(s) 23
BshFI GGCC 2 cut(s) 77, 396
BsiHKCI CYCGRG 1 cut(s) 128
BsiSI CCGG 2 cut(s) 129, 533
BslI CCNNNNNNNGG 4 cut(s) 128, 129, 233, 553
BsmAI GTCTC 1 cut(s) 455
BsnI GGCC 2 cut(s) 77, 396
Bso31I GGTCTC 1 cut(s) 455
BsoBI CYCGRG 1 cut(s) 128
Bsp143I GATC 4 cut(s) 118, 124, 475, 571
BspANI GGCC 2 cut(s) 77, 396
BspCNI CTCAG 1 cut(s) 209
BspLI GGNNCC 1 cut(s) 395
BspPI GGATC 2 cut(s) 113, 119
BspTNI GGTCTC 1 cut(s) 455
BssECI CCNNGG 1 cut(s) 128
BssMI GATC 4 cut(s) 118, 124, 475, 571
BstDEI CTNAG 3 cut(s) 2, 196, 415
BstKTI GATC 4 cut(s) 121, 127, 478, 574
BstMAI GTCTC 1 cut(s) 455
BstMBI GATC 4 cut(s) 118, 124, 475, 571
BstNSI RCATGY 1 cut(s) 590
BstSCI CCNGG 2 cut(s) 127, 128
BstV1I GCAGC 1 cut(s) 23
BstV2I GAAGAC 1 cut(s) 570
BstX2I RGATCY 1 cut(s) 118
BstYI RGATCY 1 cut(s) 118
BsuRI GGCC 2 cut(s) 77, 396
BtgZI GCGATG 1 cut(s) 54
Cfr13I GGNCC 1 cut(s) 394
Cfr9I CCCGGG 1 cut(s) 128
Csp6I GTAC 2 cut(s) 174, 491
CviAII CATG 6 cut(s) 190, 322, 390, 398, 514, 587
CviJI RGCY 8 cut(s) 14, 36, 77, 208, 348, 396, 419, 539
CviKI_1 RGCY 8 cut(s) 14, 36, 77, 208, 348, 396, 419, 539
CviQI GTAC 2 cut(s) 174, 491
DdeI CTNAG 3 cut(s) 2, 196, 415
DpnI GATC 4 cut(s) 120, 126, 477, 573
DpnII GATC 4 cut(s) 118, 124, 475, 571
Eco31I GGTCTC 1 cut(s) 455
Eco57I CTGAAG 1 cut(s) 351
Eco88I CYCGRG 1 cut(s) 128
FaeI CATG 6 cut(s) 193, 325, 393, 401, 517, 590
FatI CATG 6 cut(s) 189, 321, 389, 397, 513, 586
Fnu4HI GCNGC 2 cut(s) 15, 37
Fsp4HI GCNGC 2 cut(s) 15, 37
FspBI CTAG 2 cut(s) 183, 488
GluI GCNGC 2 cut(s) 15, 37
GsuI CTGGAG 1 cut(s) 441
HaeIII GGCC 2 cut(s) 77, 396
HapII CCGG 2 cut(s) 129, 533
Hin1II CATG 6 cut(s) 193, 325, 393, 401, 517, 590
HincII GTYRAC 1 cut(s) 544
HindII GTYRAC 1 cut(s) 544
HindIII AAGCTT 1 cut(s) 346
HinfI GANTC 2 cut(s) 7, 269
HpaII CCGG 2 cut(s) 129, 533
HphI GGTGA 1 cut(s) 389
Hpy166II GTNNAC 1 cut(s) 544
Hpy188I TCNGA 3 cut(s) 64, 274, 373
Hpy188III TCNNGA 4 cut(s) 116, 122, 409, 434
Hpy8I GTNNAC 1 cut(s) 544
HpyAV CCTTC 2 cut(s) 133, 326
HpyCH4V TGCA 2 cut(s) 17, 136
HpyF3I CTNAG 3 cut(s) 2, 196, 415
Hsp92II CATG 6 cut(s) 193, 325, 393, 401, 517, 590
Kzo9I GATC 4 cut(s) 118, 124, 475, 571
LpnPI CCDG 5 cut(s) 142, 149, 394, 405, 546
Lsp1109I GCAGC 1 cut(s) 23
MaeI CTAG 2 cut(s) 183, 488
MalI GATC 4 cut(s) 120, 126, 477, 573
MboI GATC 4 cut(s) 118, 124, 475, 571
MboII GAAGA 3 cut(s) 80, 212, 575
MfeI CAATTG 1 cut(s) 89
MflI RGATCY 1 cut(s) 118
MluCI AATT 4 cut(s) 89, 168, 426, 601
MnlI CCTC 8 cut(s) 102, 153, 187, 205, 273, 299, 510, 550
MseI TTAA 4 cut(s) 24, 212, 350, 551
MslI CAYNNNNRTG 1 cut(s) 402
MspI CCGG 2 cut(s) 129, 533
MspR9I CCNGG 2 cut(s) 129, 130
MunI CAATTG 1 cut(s) 89
NciI CCSGG 2 cut(s) 129, 130
NdeII GATC 4 cut(s) 118, 124, 475, 571
NlaIII CATG 6 cut(s) 193, 325, 393, 401, 517, 590
NlaIV GGNNCC 1 cut(s) 395
NspI RCATGY 1 cut(s) 590
PfeI GAWTC 2 cut(s) 7, 269
PflFI GACNNNGTC 1 cut(s) 322
PflMI CCANNNNNTGG 1 cut(s) 233
PkrI GCNGC 2 cut(s) 16, 38
PspN4I GGNNCC 1 cut(s) 395
PspPI GGNCC 1 cut(s) 394
PsuI RGATCY 1 cut(s) 118
PsyI GACNNNGTC 1 cut(s) 322
RsaI GTAC 2 cut(s) 175, 492
RsaNI GTAC 2 cut(s) 174, 491
RseI CAYNNNNRTG 1 cut(s) 402
SaqAI TTAA 4 cut(s) 24, 212, 350, 551
SatI GCNGC 2 cut(s) 15, 37
Sau3AI GATC 4 cut(s) 118, 124, 475, 571
Sau96I GGNCC 1 cut(s) 394
ScrFI CCNGG 2 cut(s) 129, 130
SmaI CCCGGG 1 cut(s) 130
SmiMI CAYNNNNRTG 1 cut(s) 402
SmlI CTYRAG 2 cut(s) 149, 432
SmoI CTYRAG 2 cut(s) 149, 432
SpeI ACTAGT 2 cut(s) 182, 487
Sse9I AATT 4 cut(s) 89, 168, 426, 601
SspMI CTAG 2 cut(s) 183, 488
StyD4I CCNGG 2 cut(s) 127, 128
TaqI TCGA 1 cut(s) 10
TasI AATT 4 cut(s) 89, 168, 426, 601
TatI WGTACW 1 cut(s) 490
TfiI GAWTC 2 cut(s) 7, 269
Tru1I TTAA 4 cut(s) 24, 212, 350, 551
Tru9I TTAA 4 cut(s) 24, 212, 350, 551
TseI GCWGC 2 cut(s) 14, 36
TspDTI ATGAA 4 cut(s) 81, 270, 378, 414
TspMI CCCGGG 1 cut(s) 128
Tth111I GACNNNGTC 1 cut(s) 322
Van91I CCANNNNNTGG 1 cut(s) 233
XapI RAATTY 2 cut(s) 168, 601
XceI RCATGY 1 cut(s) 590
XmaI CCCGGG 1 cut(s) 128
XspI CTAG 2 cut(s) 183, 488
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.