Rmu_co8490065.1_g000001

Synaptotagmin-3-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8490065.1
Physical Location & Seq
Reverse (-)
2 .. 2084
2083 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8490065.1_g000001.1.cds

Sequence Viewer

Length: 701 bp
atggatccagatataaaatcactaaatgagtgtgatccaaactctctggttgatcttttctcagagattcctccatgggtgaagcaccctgactttgaaagaattgattggttgaacaaggctttacatgatatgtggccttaccttgataaggcaatatgcaagattatcagagaaacagcagagccaatatttgcagagtacgttggaaaatatcagataagatccataggatttcaaagcttgaatcttggaagtcttgctcctacaatttatggtattagagtgcacgaaaccaatgaaaatgaactagtaattgaacctgctattagatgggcaggaattccacacataactgttgtggtaaaaatattgtcagttcgacttatagttcagctgatggatgtccaagtatttgcaacgccaaggatgatcttaaggcctcttgtaccaacattcccatgttttggaaacataacactgactttgatagacaagccacatgtggactttggactcagattactgggaggggatgttatggcaatccccggtttctatcaatttgttcaggaatatataagaaatcaagttgctagcctttatttatggccccaaactttgaacataccaatccttcagggttcattatcaggaactataaagaagcctgtaggcatactgcatgtcaaggttgtaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

233

Amino Acids

26.45

Weight (kDa)

6.3

Isoelectric Point (pI)

35.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 331
AccB7I CCANNNNNTGG 1 cut(s) 467
AclWI GGATC 3 cut(s) 12, 29, 219
AcsI RAATTY 1 cut(s) 342
AcuI CTGAAG 1 cut(s) 623
AfaI GTAC 2 cut(s) 203, 450
AfiI CCNNNNNNNGG 2 cut(s) 151, 467
AflII CTTAAG 1 cut(s) 436
AflIII ACRYGT 1 cut(s) 502
AgsI TTSAA 6 cut(s) 98, 115, 239, 247, 320, 625
AhlI ACTAGT 1 cut(s) 310
AluBI AGCT 2 cut(s) 243, 397
AluI AGCT 2 cut(s) 243, 397
Alw21I GWGCWC 1 cut(s) 291
Alw44I GTGCAC 1 cut(s) 287
AlwI GGATC 3 cut(s) 12, 29, 219
AoxI GGCC 3 cut(s) 137, 440, 611
ApaLI GTGCAC 1 cut(s) 287
ApoI RAATTY 1 cut(s) 342
AspS9I GGNCC 1 cut(s) 612
AsuC2I CCSGG 1 cut(s) 552
AsuHPI GGTGA 1 cut(s) 91
AsuNHI GCTAGC 1 cut(s) 596
BaeGI GKGCMC 1 cut(s) 291
BamHI GGATCC 1 cut(s) 4
Bbv12I GWGCWC 1 cut(s) 291
BccI CCATC 2 cut(s) 327, 394
BcnI CCSGG 1 cut(s) 552
BcuI ACTAGT 1 cut(s) 310
BfaI CTAG 2 cut(s) 311, 597
BfmI CTRYAG 1 cut(s) 672
BfrI CTTAAG 1 cut(s) 436
BfuAI ACCTGC 1 cut(s) 331
Bme1390I CCNGG 1 cut(s) 552
BmgT120I GGNCC 1 cut(s) 612
BmiI GGNNCC 2 cut(s) 6, 614
BmrFI CCNGG 1 cut(s) 552
BmrI ACTGGG 1 cut(s) 536
BmtI GCTAGC 1 cut(s) 600
BmuI ACTGGG 1 cut(s) 536
BpuMI CCSGG 1 cut(s) 552
BsaJI CCNNGG 3 cut(s) 74, 425, 550
BsaXI ACNNNNNCTCC 2 cut(s) 522, 552
Bsc4I CCNNNNNNNGG 2 cut(s) 151, 467
Bse1I ACTGG 1 cut(s) 531
BseDI CCNNGG 3 cut(s) 74, 425, 550
BseGI GGATG 3 cut(s) 409, 435, 541
BseLI CCNNNNNNNGG 2 cut(s) 151, 467
BseMII CTCAG 2 cut(s) 75, 532
BseNI ACTGG 1 cut(s) 531
BseSI GKGCMC 1 cut(s) 291
BshFI GGCC 3 cut(s) 139, 442, 613
BsiHKAI GWGCWC 1 cut(s) 291
BsiSI CCGG 1 cut(s) 552
BslI CCNNNNNNNGG 2 cut(s) 151, 467
BsnI GGCC 3 cut(s) 139, 442, 613
Bsp1286I GDGCHC 1 cut(s) 291
Bsp143I GATC 5 cut(s) 4, 34, 52, 224, 432
Bsp19I CCATGG 1 cut(s) 74
BspANI GGCC 3 cut(s) 139, 442, 613
BspCNI CTCAG 2 cut(s) 74, 531
BspLI GGNNCC 2 cut(s) 6, 614
BspMI ACCTGC 1 cut(s) 331
BspOI GCTAGC 1 cut(s) 600
BspPI GGATC 3 cut(s) 12, 29, 219
BspTI CTTAAG 1 cut(s) 436
BsrI ACTGG 1 cut(s) 531
BssECI CCNNGG 3 cut(s) 74, 425, 550
BssMI GATC 5 cut(s) 4, 34, 52, 224, 432
BssT1I CCWWGG 2 cut(s) 74, 425
Bst4CI ACNGT 1 cut(s) 358
BstAFI CTTAAG 1 cut(s) 436
BstC8I GCNNGC 1 cut(s) 598
BstDEI CTNAG 2 cut(s) 61, 518
BstDSI CCRYGG 1 cut(s) 74
BstENI CCTNNNNNAGG 1 cut(s) 149
BstF5I GGATG 3 cut(s) 409, 435, 541
BstKTI GATC 5 cut(s) 7, 37, 55, 227, 435
BstMBI GATC 5 cut(s) 4, 34, 52, 224, 432
BstNSI RCATGY 2 cut(s) 506, 689
BstSCI CCNGG 1 cut(s) 550
BstSFI CTRYAG 1 cut(s) 672
BstSLI GKGCMC 1 cut(s) 291
BstX2I RGATCY 2 cut(s) 4, 224
BstYI RGATCY 2 cut(s) 4, 224
BsuRI GGCC 3 cut(s) 139, 442, 613
BtgI CCRYGG 1 cut(s) 74
BtsCI GGATG 3 cut(s) 409, 435, 541
BtsIMutI CAGTG 1 cut(s) 479
BveI ACCTGC 1 cut(s) 331
Cac8I GCNNGC 1 cut(s) 598
Cfr13I GGNCC 1 cut(s) 612
Csp6I GTAC 2 cut(s) 202, 449
CviAII CATG 5 cut(s) 75, 128, 462, 503, 686
CviQI GTAC 2 cut(s) 202, 449
DdeI CTNAG 2 cut(s) 61, 518
DpnI GATC 5 cut(s) 6, 36, 54, 226, 434
DpnII GATC 5 cut(s) 4, 34, 52, 224, 432
Eco130I CCWWGG 2 cut(s) 74, 425
Eco147I AGGCCT 1 cut(s) 442
Eco57I CTGAAG 1 cut(s) 623
EcoNI CCTNNNNNAGG 1 cut(s) 149
EcoRI GAATTC 1 cut(s) 342
EcoT14I CCWWGG 2 cut(s) 74, 425
ErhI CCWWGG 2 cut(s) 74, 425
FaeI CATG 5 cut(s) 78, 131, 465, 506, 689
FatI CATG 5 cut(s) 74, 127, 461, 502, 685
FokI GGATG 3 cut(s) 416, 442, 548
FspBI CTAG 2 cut(s) 311, 597
HaeIII GGCC 3 cut(s) 139, 442, 613
HapII CCGG 1 cut(s) 552
Hin1II CATG 5 cut(s) 78, 131, 465, 506, 689
HindIII AAGCTT 1 cut(s) 241
HinfI GANTC 3 cut(s) 67, 247, 516
HpaII CCGG 1 cut(s) 552
HphI GGTGA 1 cut(s) 91
Hpy166II GTNNAC 2 cut(s) 289, 508
Hpy188I TCNGA 4 cut(s) 64, 173, 219, 521
Hpy188III TCNNGA 3 cut(s) 8, 572, 654
Hpy8I GTNNAC 2 cut(s) 289, 508
HpyAV CCTTC 1 cut(s) 647
HpyCH4III ACNGT 1 cut(s) 358
HpyCH4IV ACGT 1 cut(s) 204
HpyCH4V TGCA 5 cut(s) 162, 197, 289, 419, 685
HpyF3I CTNAG 2 cut(s) 61, 518
HpySE526I ACGT 1 cut(s) 204
Hsp92II CATG 5 cut(s) 78, 131, 465, 506, 689
Kzo9I GATC 5 cut(s) 4, 34, 52, 224, 432
LmnI GCTCC 1 cut(s) 268
MaeI CTAG 2 cut(s) 311, 597
MaeII ACGT 1 cut(s) 204
MalI GATC 5 cut(s) 6, 36, 54, 226, 434
MboI GATC 5 cut(s) 4, 34, 52, 224, 432
MflI RGATCY 2 cut(s) 4, 224
MhlI GDGCHC 1 cut(s) 291
MluCI AATT 5 cut(s) 102, 270, 315, 342, 563
MlyI GAGTC 1 cut(s) 510
MmeI TCCRAC 1 cut(s) 187
MnlI CCTC 3 cut(s) 81, 453, 524
MseI TTAA 1 cut(s) 437
MslI CAYNNNNRTG 1 cut(s) 460
MspA1I CMGCKG 1 cut(s) 397
MspCI CTTAAG 1 cut(s) 436
MspI CCGG 1 cut(s) 552
MspR9I CCNGG 1 cut(s) 552
NciI CCSGG 1 cut(s) 552
NcoI CCATGG 1 cut(s) 74
NdeII GATC 5 cut(s) 4, 34, 52, 224, 432
NheI GCTAGC 1 cut(s) 596
NlaIII CATG 5 cut(s) 78, 131, 465, 506, 689
NlaIV GGNNCC 2 cut(s) 6, 614
NspI RCATGY 2 cut(s) 506, 689
PceI AGGCCT 1 cut(s) 442
PciI ACATGT 1 cut(s) 502
PfeI GAWTC 2 cut(s) 67, 247
PflMI CCANNNNNTGG 1 cut(s) 467
PleI GAGTC 1 cut(s) 510
PpsI GAGTC 1 cut(s) 510
PscI ACATGT 1 cut(s) 502
PspN4I GGNNCC 2 cut(s) 6, 614
PspPI GGNCC 1 cut(s) 612
PsuI RGATCY 2 cut(s) 4, 224
PvuII CAGCTG 1 cut(s) 397
RsaI GTAC 2 cut(s) 203, 450
RsaNI GTAC 2 cut(s) 202, 449
RseI CAYNNNNRTG 1 cut(s) 460
SaqAI TTAA 1 cut(s) 437
Sau3AI GATC 5 cut(s) 4, 34, 52, 224, 432
Sau96I GGNCC 1 cut(s) 612
SchI GAGTC 1 cut(s) 510
ScrFI CCNGG 1 cut(s) 552
SduI GDGCHC 1 cut(s) 291
SetI ASST 6 cut(s) 147, 207, 245, 325, 399, 696
SfcI CTRYAG 1 cut(s) 672
SmiMI CAYNNNNRTG 1 cut(s) 460
SmlI CTYRAG 1 cut(s) 436
SmoI CTYRAG 1 cut(s) 436
SpeI ACTAGT 1 cut(s) 310
Sse9I AATT 5 cut(s) 102, 270, 315, 342, 563
SseBI AGGCCT 1 cut(s) 442
SspI AATATT 2 cut(s) 192, 372
SspMI CTAG 2 cut(s) 311, 597
StuI AGGCCT 1 cut(s) 442
StyD4I CCNGG 1 cut(s) 550
StyI CCWWGG 2 cut(s) 74, 425
TaaI ACNGT 1 cut(s) 358
TaiI ACGT 1 cut(s) 207
TaqI TCGA 1 cut(s) 382
TasI AATT 5 cut(s) 102, 270, 315, 342, 563
TfiI GAWTC 2 cut(s) 67, 247
Tru1I TTAA 1 cut(s) 437
Tru9I TTAA 1 cut(s) 437
TscAI CASTG 1 cut(s) 486
TspDTI ATGAA 3 cut(s) 315, 321, 636
TspRI CASTG 1 cut(s) 486
Van91I CCANNNNNTGG 1 cut(s) 467
Vha464I CTTAAG 1 cut(s) 436
VneI GTGCAC 1 cut(s) 287
XagI CCTNNNNNAGG 1 cut(s) 149
XapI RAATTY 1 cut(s) 342
XceI RCATGY 2 cut(s) 506, 689
XspI CTAG 2 cut(s) 311, 597
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.