Rmu_sc0001018.1_g000051

cation H( ) antiporter 15-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001018.1
Physical Location & Seq
Forward (+)
215965 .. 216174
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001018.1_g000051.1.cds

Sequence Viewer

Length: 210 bp
atgaaagtaaatgatggtgtgcaagttttggaggcgattgggaagttggagggagaatacgaccttgtgatggtgggacgaaggcattcggagatgtcattgacggacgaagaaatggtggatttggtgcagaattcagagctaggagtcattggcgacatgcttgcttctgcggatttttgtgatgggacactgaatgttgtagaatag

Protein Analysis

69

Amino Acids

7.52

Weight (kDa)

4.06

Isoelectric Point (pI)

31.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 173
AcsI RAATTY 1 cut(s) 133
AfiI CCNNNNNNNGG 1 cut(s) 70
AluBI AGCT 1 cut(s) 142
AluI AGCT 1 cut(s) 142
ApoI RAATTY 1 cut(s) 133
Asp700I GAANNNNTTC 1 cut(s) 85
BccI CCATC 3 cut(s) 8, 64, 179
BcgI CGANNNNNNTGC 2 cut(s) 146, 180
BfaI CTAG 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 70
BseLI CCNNNNNNNGG 1 cut(s) 70
BsgI GTGCAG 1 cut(s) 149
BslFI GGGAC 2 cut(s) 90, 202
BslI CCNNNNNNNGG 1 cut(s) 70
BsmFI GGGAC 2 cut(s) 90, 202
BsmI GAATGC 1 cut(s) 85
BspACI CCGC 1 cut(s) 173
BstC8I GCNNGC 1 cut(s) 165
BstNSI RCATGY 1 cut(s) 163
BtsIMutI CAGTG 1 cut(s) 191
Cac8I GCNNGC 1 cut(s) 165
CviAII CATG 1 cut(s) 160
CviJI RGCY 1 cut(s) 142
CviKI_1 RGCY 1 cut(s) 142
EcoRI GAATTC 1 cut(s) 133
FaeI CATG 1 cut(s) 163
FaiI YATR 1 cut(s) 161
FaqI GGGAC 2 cut(s) 90, 202
FatI CATG 1 cut(s) 159
FspBI CTAG 1 cut(s) 143
Hin1II CATG 1 cut(s) 163
HinfI GANTC 1 cut(s) 147
Hpy188I TCNGA 2 cut(s) 91, 139
HpyAV CCTTC 1 cut(s) 75
HpyCH4V TGCA 2 cut(s) 22, 130
Hsp92II CATG 1 cut(s) 163
MaeI CTAG 1 cut(s) 143
MboII GAAGA 1 cut(s) 122
MluCI AATT 1 cut(s) 133
MlyI GAGTC 1 cut(s) 156
MmeI TCCRAC 1 cut(s) 27
MnlI CCTC 2 cut(s) 25, 43
MroXI GAANNNNTTC 1 cut(s) 85
Mva1269I GAATGC 1 cut(s) 85
NlaIII CATG 1 cut(s) 163
NspI RCATGY 1 cut(s) 163
PctI GAATGC 1 cut(s) 85
PdmI GAANNNNTTC 1 cut(s) 85
PleI GAGTC 1 cut(s) 155
PpsI GAGTC 1 cut(s) 155
SchI GAGTC 1 cut(s) 156
SetI ASST 2 cut(s) 66, 144
SgeI CNNG 5 cut(s) 35, 77, 155, 172, 176
Sse9I AATT 1 cut(s) 133
SsiI CCGC 1 cut(s) 173
SspMI CTAG 1 cut(s) 143
TasI AATT 1 cut(s) 133
TscAI CASTG 1 cut(s) 198
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 119
TspRI CASTG 1 cut(s) 198
XapI RAATTY 1 cut(s) 133
XceI RCATGY 1 cut(s) 163
XmnI GAANNNNTTC 1 cut(s) 85
XspI CTAG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.