Rmu_sc0001524.1_g000007

Proton pump-interactor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001524.1
Physical Location & Seq
Forward (+)
16865 .. 17852
988 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001524.1_g000007.1.cds

Sequence Viewer

Length: 492 bp
atgggttattcgatctgggaaatagcgaaggccttcatcaacgaccagtttgagctcgccgttgacctctacacccaggccatcgccgtcgaccccaacaactccgagttttgctccaacaacgctcaggccaacatcaaatccaataatctcaccgctacgggtaaccaagatttgaattcgaacaatggagctgtggatttgggattgaaggcaaaaatgtcaaaattggggctaagaaggtttctaggactttggtctgtaaggctgttctttggtggaagatatggggtcgaagatttgggatttgagaaggtccaaggaccagttgggactgtcattgaaggagagaattccaccaaggaaaatgggaaattagaagaagggtcaggccataatgagcccataaaatttggttcacatggtgatgaaatggctaaaaaggaaaggaatggggtcaatggcgatggaacttgtgagaattctccctag

Protein Analysis

163

Amino Acids

17.63

Weight (kDa)

4.96

Isoelectric Point (pI)

23.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 90
AciI CCGC 1 cut(s) 156
AcsI RAATTY 4 cut(s) 178, 352, 410, 481
AdeI CACNNNGTG 1 cut(s) 425
AgsI TTSAA 3 cut(s) 178, 211, 344
AjnI CCWGG 1 cut(s) 75
AluBI AGCT 2 cut(s) 55, 194
AluI AGCT 2 cut(s) 55, 194
Alw21I GWGCWC 1 cut(s) 57
AoxI GGCC 4 cut(s) 30, 78, 129, 391
ApoI RAATTY 4 cut(s) 178, 352, 410, 481
Asp700I GAANNNNTTC 1 cut(s) 32
AspS9I GGNCC 2 cut(s) 316, 323
AsuHPI GGTGA 2 cut(s) 145, 437
AsuII TTCGAA 1 cut(s) 182
AvaII GGWCC 2 cut(s) 316, 323
BanII GRGCYC 2 cut(s) 57, 405
Bbv12I GWGCWC 1 cut(s) 57
BccI CCATC 2 cut(s) 89, 461
BceAI ACGGC 2 cut(s) 44, 71
BciT130I CCWGG 1 cut(s) 77
BfaI CTAG 2 cut(s) 248, 490
Bme1390I CCNGG 1 cut(s) 77
Bme18I GGWCC 2 cut(s) 316, 323
BmgT120I GGNCC 2 cut(s) 316, 323
BmrFI CCNGG 1 cut(s) 77
BoxI GACNNNNGTC 1 cut(s) 256
BplI GAGNNNNNCTC 2 cut(s) 98, 130
Bpu10I CCTNAGC 1 cut(s) 126
Bpu14I TTCGAA 1 cut(s) 182
BsaJI CCNNGG 3 cut(s) 75, 319, 360
Bse1I ACTGG 2 cut(s) 46, 326
BseBI CCWGG 1 cut(s) 77
BseDI CCNNGG 3 cut(s) 75, 319, 360
BseMII CTCAG 1 cut(s) 140
BseNI ACTGG 2 cut(s) 46, 326
BshFI GGCC 4 cut(s) 32, 80, 131, 393
BsiHKAI GWGCWC 1 cut(s) 57
BslFI GGGAC 1 cut(s) 346
BsmFI GGGAC 1 cut(s) 346
BsnI GGCC 4 cut(s) 32, 80, 131, 393
Bsp119I TTCGAA 1 cut(s) 182
Bsp1286I GDGCHC 2 cut(s) 57, 405
Bsp143I GATC 1 cut(s) 12
BspACI CCGC 1 cut(s) 156
BspANI GGCC 4 cut(s) 32, 80, 131, 393
BspCNI CTCAG 1 cut(s) 139
BspT104I TTCGAA 1 cut(s) 182
BsrI ACTGG 2 cut(s) 46, 326
BssECI CCNNGG 3 cut(s) 75, 319, 360
BssMI GATC 1 cut(s) 12
BssT1I CCWWGG 2 cut(s) 319, 360
Bst2UI CCWGG 1 cut(s) 77
Bst4CI ACNGT 1 cut(s) 337
BstBI TTCGAA 1 cut(s) 182
BstC8I GCNNGC 1 cut(s) 57
BstDEI CTNAG 2 cut(s) 126, 236
BstEII GGTNACC 1 cut(s) 164
BstKTI GATC 1 cut(s) 15
BstMBI GATC 1 cut(s) 12
BstNI CCWGG 1 cut(s) 77
BstPAI GACNNNNGTC 1 cut(s) 256
BstPI GGTNACC 1 cut(s) 164
BstSCI CCNGG 1 cut(s) 75
BsuRI GGCC 4 cut(s) 32, 80, 131, 393
BtgZI GCGATG 2 cut(s) 67, 480
Cac8I GCNNGC 1 cut(s) 57
Cfr13I GGNCC 2 cut(s) 316, 323
CviAII CATG 1 cut(s) 422
DdeI CTNAG 2 cut(s) 126, 236
DpnI GATC 1 cut(s) 14
DpnII GATC 1 cut(s) 12
DraIII CACNNNGTG 1 cut(s) 425
Ecl136II GAGCTC 1 cut(s) 55
Eco130I CCWWGG 2 cut(s) 319, 360
Eco147I AGGCCT 1 cut(s) 32
Eco24I GRGCYC 2 cut(s) 57, 405
Eco47I GGWCC 2 cut(s) 316, 323
Eco53kI GAGCTC 1 cut(s) 55
Eco91I GGTNACC 1 cut(s) 164
EcoICRI GAGCTC 1 cut(s) 55
EcoO65I GGTNACC 1 cut(s) 164
EcoRI GAATTC 3 cut(s) 178, 352, 481
EcoRII CCWGG 1 cut(s) 75
EcoT14I CCWWGG 2 cut(s) 319, 360
EcoT38I GRGCYC 2 cut(s) 57, 405
ErhI CCWWGG 2 cut(s) 319, 360
FaeI CATG 1 cut(s) 425
FaiI YATR 4 cut(s) 288, 396, 407, 423
FaqI GGGAC 1 cut(s) 346
FatI CATG 1 cut(s) 421
FblI GTMKAC 1 cut(s) 90
FriOI GRGCYC 2 cut(s) 57, 405
FspBI CTAG 2 cut(s) 248, 490
HaeIII GGCC 4 cut(s) 32, 80, 131, 393
Hin1II CATG 1 cut(s) 425
HincII GTYRAC 2 cut(s) 64, 91
HindII GTYRAC 2 cut(s) 64, 91
HphI GGTGA 2 cut(s) 145, 437
Hpy166II GTNNAC 3 cut(s) 64, 91, 419
Hpy188I TCNGA 1 cut(s) 106
Hpy8I GTNNAC 3 cut(s) 64, 91, 419
Hpy99I CGWCG 1 cut(s) 92
HpyAV CCTTC 7 cut(s) 22, 43, 205, 234, 307, 338, 377
HpyCH4III ACNGT 1 cut(s) 337
HpyF3I CTNAG 2 cut(s) 126, 236
Hsp92II CATG 1 cut(s) 425
Kzo9I GATC 1 cut(s) 12
LmnI GCTCC 2 cut(s) 119, 191
LpnPI CCDG 6 cut(s) 59, 62, 89, 113, 339, 375
MaeI CTAG 2 cut(s) 248, 490
MaeIII GTNAC 1 cut(s) 164
MalI GATC 1 cut(s) 14
MboI GATC 1 cut(s) 12
MboII GAAGA 3 cut(s) 294, 308, 392
MhlI GDGCHC 2 cut(s) 57, 405
MluCI AATT 6 cut(s) 178, 227, 352, 374, 410, 481
MmeI TCCRAC 1 cut(s) 141
MnlI CCTC 1 cut(s) 77
MroXI GAANNNNTTC 1 cut(s) 32
MslI CAYNNNNRTG 1 cut(s) 426
MspR9I CCNGG 1 cut(s) 77
MvaI CCWGG 1 cut(s) 77
NdeII GATC 1 cut(s) 12
NlaIII CATG 1 cut(s) 425
NspV TTCGAA 1 cut(s) 182
PceI AGGCCT 1 cut(s) 32
PdmI GAANNNNTTC 1 cut(s) 32
PshAI GACNNNNGTC 1 cut(s) 256
Psp124BI GAGCTC 1 cut(s) 57
Psp6I CCWGG 1 cut(s) 75
PspEI GGTNACC 1 cut(s) 164
PspGI CCWGG 1 cut(s) 75
PspPI GGNCC 2 cut(s) 316, 323
RseI CAYNNNNRTG 1 cut(s) 426
SacI GAGCTC 1 cut(s) 57
SalI GTCGAC 1 cut(s) 89
Sau3AI GATC 1 cut(s) 12
Sau96I GGNCC 2 cut(s) 316, 323
ScrFI CCNGG 1 cut(s) 77
SduI GDGCHC 2 cut(s) 57, 405
SetI ASST 5 cut(s) 57, 69, 196, 245, 318
SfuI TTCGAA 1 cut(s) 182
SinI GGWCC 2 cut(s) 316, 323
SmiMI CAYNNNNRTG 1 cut(s) 426
Sse9I AATT 6 cut(s) 178, 227, 352, 374, 410, 481
SseBI AGGCCT 1 cut(s) 32
SsiI CCGC 1 cut(s) 156
SspMI CTAG 2 cut(s) 248, 490
SstI GAGCTC 1 cut(s) 57
StuI AGGCCT 1 cut(s) 32
StyD4I CCNGG 1 cut(s) 75
StyI CCWWGG 2 cut(s) 319, 360
TaaI ACNGT 1 cut(s) 337
TaqI TCGA 4 cut(s) 11, 90, 182, 294
TasI AATT 6 cut(s) 178, 227, 352, 374, 410, 481
TspDTI ATGAA 2 cut(s) 25, 444
VpaK11BI GGWCC 2 cut(s) 316, 323
XapI RAATTY 4 cut(s) 178, 352, 410, 481
XcmI CCANNNNNNNNNTGG 1 cut(s) 326
XmiI GTMKAC 1 cut(s) 90
XmnI GAANNNNTTC 1 cut(s) 32
XspI CTAG 2 cut(s) 248, 490
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.