Rmu_sc0014348.1_g000012

UPF0051 protein ABCI8

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014348.1
Physical Location & Seq
Reverse (-)
23281 .. 24986
1706 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014348.1_g000012.1.cds

Sequence Viewer

Length: 222 bp
atgattattggagataatgcagctgccaacacctacccatacattgaggtcaagaatcctacaactcgcattgaacatgaagccagtacctccaaaattggtgaagaccagcaattttactttcagcaaaggggaatagactatgagaaagccatggctgccatgatatctcgtttttgccaggcagtatttaatgagcttccttacgagtttgggtcttag

Protein Analysis

73

Amino Acids

8.35

Weight (kDa)

4.72

Isoelectric Point (pI)

31.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 88
AgsI TTSAA 1 cut(s) 74
AjnI CCWGG 1 cut(s) 180
AluBI AGCT 2 cut(s) 23, 199
AluI AGCT 2 cut(s) 23, 199
ApeKI GCWGC 3 cut(s) 20, 23, 158
AsuHPI GGTGA 1 cut(s) 113
BbsI GAAGAC 1 cut(s) 111
BbvI GCAGC 3 cut(s) 10, 32, 145
BciT130I CCWGG 1 cut(s) 182
BisI GCNGC 3 cut(s) 21, 24, 159
BlsI GCNGC 3 cut(s) 22, 25, 160
Bme1390I CCNGG 1 cut(s) 182
BmrFI CCNGG 1 cut(s) 182
BpiI GAAGAC 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 84
BseBI CCWGG 1 cut(s) 182
BseDI CCNNGG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 84
BseXI GCAGC 3 cut(s) 10, 32, 145
Bsp19I CCATGG 1 cut(s) 153
BsrI ACTGG 1 cut(s) 84
BssECI CCNNGG 1 cut(s) 153
BssT1I CCWWGG 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 219
BstDSI CCRYGG 1 cut(s) 153
BstMWI GCNNNNNNNGC 1 cut(s) 158
BstNI CCWGG 1 cut(s) 182
BstSCI CCNGG 1 cut(s) 180
BstV1I GCAGC 3 cut(s) 10, 32, 145
BstV2I GAAGAC 1 cut(s) 111
BtgI CCRYGG 1 cut(s) 153
Csp6I GTAC 1 cut(s) 87
CviAII CATG 3 cut(s) 77, 154, 163
CviJI RGCY 5 cut(s) 23, 83, 152, 158, 199
CviKI_1 RGCY 5 cut(s) 23, 83, 152, 158, 199
CviQI GTAC 1 cut(s) 87
DdeI CTNAG 1 cut(s) 219
Eco130I CCWWGG 1 cut(s) 153
Eco32I GATATC 1 cut(s) 168
EcoRII CCWGG 1 cut(s) 180
EcoRV GATATC 1 cut(s) 168
EcoT14I CCWWGG 1 cut(s) 153
ErhI CCWWGG 1 cut(s) 153
FaeI CATG 3 cut(s) 80, 157, 166
FaiI YATR 5 cut(s) 40, 78, 144, 155, 164
FatI CATG 3 cut(s) 76, 153, 162
Fnu4HI GCNGC 3 cut(s) 21, 24, 159
Fsp4HI GCNGC 3 cut(s) 21, 24, 159
GluI GCNGC 3 cut(s) 21, 24, 159
Hin1II CATG 3 cut(s) 80, 157, 166
HinfI GANTC 1 cut(s) 55
HphI GGTGA 1 cut(s) 113
Hpy188III TCNNGA 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 20
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
HpyF3I CTNAG 1 cut(s) 219
Hsp92II CATG 3 cut(s) 80, 157, 166
LpnPI CCDG 4 cut(s) 97, 122, 167, 194
Lsp1109I GCAGC 3 cut(s) 10, 32, 145
MboII GAAGA 1 cut(s) 116
MluCI AATT 2 cut(s) 96, 113
MnlI CCTC 2 cut(s) 40, 100
MseI TTAA 1 cut(s) 192
MspA1I CMGCKG 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 182
MvaI CCWGG 1 cut(s) 182
MwoI GCNNNNNNNGC 1 cut(s) 158
NcoI CCATGG 1 cut(s) 153
NlaIII CATG 3 cut(s) 80, 157, 166
PfeI GAWTC 1 cut(s) 55
PkrI GCNGC 3 cut(s) 22, 25, 160
Psp6I CCWGG 1 cut(s) 180
PspGI CCWGG 1 cut(s) 180
PvuII CAGCTG 1 cut(s) 23
RsaI GTAC 1 cut(s) 88
RsaNI GTAC 1 cut(s) 87
SaqAI TTAA 1 cut(s) 192
SatI GCNGC 3 cut(s) 21, 24, 159
ScrFI CCNGG 1 cut(s) 182
SetI ASST 5 cut(s) 25, 35, 51, 92, 201
Sse9I AATT 2 cut(s) 96, 113
StyD4I CCNGG 1 cut(s) 180
StyI CCWWGG 1 cut(s) 153
TasI AATT 2 cut(s) 96, 113
TfiI GAWTC 1 cut(s) 55
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TseI GCWGC 3 cut(s) 20, 23, 158
TspDTI ATGAA 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.