Rh4DG442000

Proton pump-interactor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
64345626 .. 64345832
207 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG442000.1

Sequence Viewer

Length: 207 bp
ATGGGGGTTGAAGATTTGGGATTTGAGAAGGTCCAAGGACCAGTTGGGACTGTCACTAAAAGAGAGAATTCCGCCAAGGAAAATGGGAAACTGGAAGAAGGGTCAGGCCATAATGAGCCCATAAAATTTGGATCACATGGTGATGAAATGGCTAAAAAGGAAAGGAATGGGGTCAACGGCGATGGAACTTGTGAGAATTCTCCCTAG

Protein Analysis

68

Amino Acids

7.22

Weight (kDa)

5.07

Isoelectric Point (pI)

23.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 72
AclWI GGATC 1 cut(s) 139
AcsI RAATTY 3 cut(s) 67, 125, 196
AdeI CACNNNGTG 1 cut(s) 140
AgsI TTSAA 1 cut(s) 11
AlwI GGATC 1 cut(s) 139
AoxI GGCC 1 cut(s) 106
ApoI RAATTY 3 cut(s) 67, 125, 196
AspS9I GGNCC 2 cut(s) 31, 38
AsuHPI GGTGA 1 cut(s) 152
AvaII GGWCC 2 cut(s) 31, 38
BanII GRGCYC 1 cut(s) 120
BccI CCATC 1 cut(s) 176
BceAI ACGGC 1 cut(s) 193
BfaI CTAG 1 cut(s) 205
Bme18I GGWCC 2 cut(s) 31, 38
BmgT120I GGNCC 2 cut(s) 31, 38
BsaJI CCNNGG 2 cut(s) 34, 75
Bse1I ACTGG 2 cut(s) 41, 96
BseDI CCNNGG 2 cut(s) 34, 75
BseNI ACTGG 2 cut(s) 41, 96
BshFI GGCC 1 cut(s) 108
BslFI GGGAC 1 cut(s) 61
BsmFI GGGAC 1 cut(s) 61
BsnI GGCC 1 cut(s) 108
Bsp1286I GDGCHC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 131
BspACI CCGC 1 cut(s) 72
BspANI GGCC 1 cut(s) 108
BspPI GGATC 1 cut(s) 139
BsrI ACTGG 2 cut(s) 41, 96
BssECI CCNNGG 2 cut(s) 34, 75
BssMI GATC 1 cut(s) 131
BssT1I CCWWGG 2 cut(s) 34, 75
Bst4CI ACNGT 1 cut(s) 52
BstKTI GATC 1 cut(s) 134
BstMBI GATC 1 cut(s) 131
BsuRI GGCC 1 cut(s) 108
BtgZI GCGATG 1 cut(s) 195
Cfr13I GGNCC 2 cut(s) 31, 38
CviAII CATG 1 cut(s) 137
CviJI RGCY 3 cut(s) 108, 118, 152
CviKI_1 RGCY 3 cut(s) 108, 118, 152
DpnI GATC 1 cut(s) 133
DpnII GATC 1 cut(s) 131
DraIII CACNNNGTG 1 cut(s) 140
EciI GGCGGA 1 cut(s) 61
Eco130I CCWWGG 2 cut(s) 34, 75
Eco24I GRGCYC 1 cut(s) 120
Eco47I GGWCC 2 cut(s) 31, 38
EcoRI GAATTC 2 cut(s) 67, 196
EcoT14I CCWWGG 2 cut(s) 34, 75
EcoT38I GRGCYC 1 cut(s) 120
ErhI CCWWGG 2 cut(s) 34, 75
FaeI CATG 1 cut(s) 140
FaiI YATR 3 cut(s) 111, 122, 138
FaqI GGGAC 1 cut(s) 61
FatI CATG 1 cut(s) 136
FriOI GRGCYC 1 cut(s) 120
FspBI CTAG 1 cut(s) 205
HaeIII GGCC 1 cut(s) 108
Hin1II CATG 1 cut(s) 140
HincII GTYRAC 1 cut(s) 175
HindII GTYRAC 1 cut(s) 175
HphI GGTGA 1 cut(s) 152
Hpy166II GTNNAC 1 cut(s) 175
Hpy8I GTNNAC 1 cut(s) 175
HpyAV CCTTC 2 cut(s) 22, 92
HpyCH4III ACNGT 1 cut(s) 52
Hsp92II CATG 1 cut(s) 140
Kzo9I GATC 1 cut(s) 131
LpnPI CCDG 3 cut(s) 54, 77, 90
MaeI CTAG 1 cut(s) 205
MaeIII GTNAC 1 cut(s) 52
MalI GATC 1 cut(s) 133
MboI GATC 1 cut(s) 131
MboII GAAGA 2 cut(s) 23, 107
MhlI GDGCHC 1 cut(s) 120
MluCI AATT 3 cut(s) 67, 125, 196
MslI CAYNNNNRTG 1 cut(s) 141
NdeII GATC 1 cut(s) 131
NlaIII CATG 1 cut(s) 140
NmuCI GTSAC 1 cut(s) 52
PspPI GGNCC 2 cut(s) 31, 38
RseI CAYNNNNRTG 1 cut(s) 141
Sau3AI GATC 1 cut(s) 131
Sau96I GGNCC 2 cut(s) 31, 38
SduI GDGCHC 1 cut(s) 120
SetI ASST 1 cut(s) 33
SgeI CNNG 7 cut(s) 47, 53, 88, 104, 117, 149, 201
SinI GGWCC 2 cut(s) 31, 38
SmiMI CAYNNNNRTG 1 cut(s) 141
Sse9I AATT 3 cut(s) 67, 125, 196
SsiI CCGC 1 cut(s) 72
SspMI CTAG 1 cut(s) 205
StyI CCWWGG 2 cut(s) 34, 75
TaaI ACNGT 1 cut(s) 52
TasI AATT 3 cut(s) 67, 125, 196
TseFI GTSAC 1 cut(s) 52
Tsp45I GTSAC 1 cut(s) 52
TspDTI ATGAA 1 cut(s) 159
VpaK11BI GGWCC 2 cut(s) 31, 38
XapI RAATTY 3 cut(s) 67, 125, 196
XcmI CCANNNNNNNNNTGG 1 cut(s) 41
XspI CTAG 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.