Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001840.1

Orthogroup ID

OG0002017

Physical Location & Seq

Genomic Coordinates Reverse (-)

66993 .. 67454

Gene Structure 462 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001840.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 462 bp

atgacacgttactacacatactatacaaacaaccagaatggggcggacgacttcaatgagtgcgatccaacaccgtatgaaggtggatacgacataggattgatttacggacgtcctctgccgccatcggaggagatatgttatcgccgctcgtcgtctccggcaaaggataacaactacgactcgccggagttcaaatcatctgagccaaatgcgtatgacgagaagaagtcggaatccgaatacagcagttacatacgacagtcgtcacataaggaaaacaatgaaaatccagatttgaaacaaaatcaacagcaaccaaaaccacaagaagagcaacgacagaggtctagtgaatcttccagggaggaagagcctactctggccggtgaaggaggctacggtggtcgcaataaagtaagaattgagaaccaaaacattaccttaattacttgcaattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003729 GO:0005488 GO:0005543 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0008289 GO:0043167 GO:0043168 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0070300 GO:0097159 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

153

Amino Acids

17.63

Weight (kDa)

4.72

Isoelectric Point (pI)

87.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002017)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G29075
fragaria_vesca	FvH4_2g10581 FvH4_4g17390 FvH4_6g48020 FvH4_6g48030 FvH4_6g48030 FvH4_6g48030
malus_domestica	MD09G1054700.v1.1 MD09G1054800.v1.1 MD17G1052800.v1.1 MD17G1052900.v1.1
prunus_persica	Prupe.3G263700_v2.0.a1 Prupe.3G263800_v2.0.a1
pyrus_communis	pycom111g04600 pycom17g05080
rosa_chinensis	RchiOBHm_Chr2g0167311 RchiOBHm_Chr2g0167321
rosa_laevigata	RLG00000021706 RLG00000021708 RLG00000021731 RLG00000024056 RLG00000035185
rosa_multiflora	Rmu_sc0001840.1_g000012 Rmu_sc0001840.1_g000017 Rmu_sc0014204.1_g000003 Rmu_sc0014204.1_g000007
rosa_roxburghii	Rroxscaffold_2G00083600 Rroxscaffold_2G00083620 Rroxscaffold_7G00180460
rosa_rugosa	Rorug02G0529400 Rorug02G0529500 Rorug05G0310100
rosa_samantha	Rh2AG596400 Rh2AG596500 Rh2BG607800 Rh2BG607900 Rh2CG578500 Rh2CG578700 Rh2DG619200 Rh2DG619300 Rh5BG389900 Rh5BG486900 Rh5CG511300 Rh6AG351500
rosa_wichuraiana	Rw2G049640

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	115
AccBSI	CCGCTC	1 cut(s)	150
AciI	CCGC	3 cut(s)	44, 122, 148
AclWI	GGATC	1 cut(s)	59
AcoI	YGGCCR	1 cut(s)	384
AcyI	GRCGYC	1 cut(s)	112
AfiI	CCNNNNNNNGG	2 cut(s)	40, 80
AflIII	ACRYGT	1 cut(s)	5
AgsI	TTSAA	3 cut(s)	55, 196, 301
AjnI	CCWGG	1 cut(s)	362
Alw26I	GTCTC	1 cut(s)	162
AlwI	GGATC	1 cut(s)	59
AoxI	GGCC	1 cut(s)	384
AsuHPI	GGTGA	1 cut(s)	401
BccI	CCATC	1 cut(s)	133
BciT130I	CCWGG	1 cut(s)	364
BciVI	GTATCC	1 cut(s)	80
BcoDI	GTCTC	1 cut(s)	162
BfaI	CTAG	1 cut(s)	351
BfuI	GTATCC	1 cut(s)	80
BisI	GCNGC	2 cut(s)	122, 148
BlsI	GCNGC	2 cut(s)	123, 149
Bme1390I	CCNGG	1 cut(s)	364
BmrFI	CCNGG	1 cut(s)	364
BoxI	GACNNNNGTC	2 cut(s)	265, 346
BsaHI	GRCGYC	1 cut(s)	112
BsaJI	CCNNGG	1 cut(s)	363
Bsc4I	CCNNNNNNNGG	2 cut(s)	40, 80
Bse118I	RCCGGY	1 cut(s)	386
BseBI	CCWGG	1 cut(s)	364
BseDI	CCNNGG	1 cut(s)	363
BseLI	CCNNNNNNNGG	2 cut(s)	40, 80
BseMII	CTCAG	1 cut(s)	195
BseRI	GAGGAG	1 cut(s)	146
BshFI	GGCC	1 cut(s)	386
BsiSI	CCGG	3 cut(s)	161, 188, 387
BslI	CCNNNNNNNGG	2 cut(s)	40, 80
BsmAI	GTCTC	1 cut(s)	162
BsmBI	CGTCTC	1 cut(s)	162
BsnI	GGCC	1 cut(s)	386
Bsp143I	GATC	1 cut(s)	64
BspACI	CCGC	3 cut(s)	44, 122, 148
BspANI	GGCC	1 cut(s)	386
BspCNI	CTCAG	1 cut(s)	196
BspPI	GGATC	1 cut(s)	59
BspQI	GCTCTTC	2 cut(s)	327, 366
BsrBI	CCGCTC	1 cut(s)	150
BsrFI	RCCGGY	1 cut(s)	386
BssAI	RCCGGY	1 cut(s)	386
BssECI	CCNNGG	1 cut(s)	363
BssMI	GATC	1 cut(s)	64
BssNI	GRCGYC	1 cut(s)	112
Bst2UI	CCWGG	1 cut(s)	364
Bst4CI	ACNGT	3 cut(s)	75, 264, 404
Bst6I	CTCTTC	2 cut(s)	327, 366
BstACI	GRCGYC	1 cut(s)	112
BstDEI	CTNAG	1 cut(s)	204
BstKTI	GATC	1 cut(s)	67
BstMAI	GTCTC	1 cut(s)	162
BstMBI	GATC	1 cut(s)	64
BstNI	CCWGG	1 cut(s)	364
BstPAI	GACNNNNGTC	2 cut(s)	265, 346
BstSCI	CCNGG	1 cut(s)	362
BsuI	GTATCC	1 cut(s)	80
BsuRI	GGCC	1 cut(s)	386
Cfr10I	RCCGGY	1 cut(s)	386
CviJI	RGCY	4 cut(s)	208, 376, 386, 399
CviKI_1	RGCY	4 cut(s)	208, 376, 386, 399
DdeI	CTNAG	1 cut(s)	204
DpnI	GATC	1 cut(s)	66
DpnII	GATC	1 cut(s)	64
EaeI	YGGCCR	1 cut(s)	384
Eam1104I	CTCTTC	2 cut(s)	327, 366
EarI	CTCTTC	2 cut(s)	327, 366
EciI	GGCGGA	1 cut(s)	59
EcoRII	CCWGG	1 cut(s)	362
Esp3I	CGTCTC	1 cut(s)	162
FaiI	YATR	8 cut(s)	19, 24, 78, 95, 139, 219, 257, 273
Fnu4HI	GCNGC	2 cut(s)	122, 148
Fsp4HI	GCNGC	2 cut(s)	122, 148
FspBI	CTAG	1 cut(s)	351
GluI	GCNGC	2 cut(s)	122, 148
HaeIII	GGCC	1 cut(s)	386
HapII	CCGG	3 cut(s)	161, 188, 387
Hin1I	GRCGYC	1 cut(s)	112
HinfI	GANTC	3 cut(s)	182, 236, 356
HpaII	CCGG	3 cut(s)	161, 188, 387
HphI	GGTGA	1 cut(s)	401
Hpy188I	TCNGA	4 cut(s)	130, 205, 235, 241
Hpy188III	TCNNGA	1 cut(s)	293
Hpy99I	CGWCG	1 cut(s)	157
HpyAV	CCTTC	2 cut(s)	74, 386
HpyCH4III	ACNGT	3 cut(s)	75, 264, 404
HpyCH4IV	ACGT	2 cut(s)	7, 112
HpyCH4V	TGCA	1 cut(s)	456
HpyF3I	CTNAG	1 cut(s)	204
HpySE526I	ACGT	2 cut(s)	7, 112
Hsp92I	GRCGYC	1 cut(s)	112
Kzo9I	GATC	1 cut(s)	64
LguI	GCTCTTC	2 cut(s)	327, 366
LpnPI	CCDG	8 cut(s)	47, 174, 201, 306, 349, 368, 376, 400
MaeI	CTAG	1 cut(s)	351
MaeII	ACGT	2 cut(s)	7, 112
MaeIII	GTNAC	3 cut(s)	8, 251, 267
MalI	GATC	1 cut(s)	66
MbiI	CCGCTC	1 cut(s)	150
MboI	GATC	1 cut(s)	64
MboII	GAAGA	4 cut(s)	238, 344, 351, 383
MluCI	AATT	3 cut(s)	423, 447, 457
MlyI	GAGTC	1 cut(s)	176
MmeI	TCCRAC	2 cut(s)	92, 213
MnlI	CCTC	5 cut(s)	124, 126, 339, 361, 389
MseI	TTAA	2 cut(s)	446, 460
MspI	CCGG	3 cut(s)	161, 188, 387
MspR9I	CCNGG	1 cut(s)	364
MvaI	CCWGG	1 cut(s)	364
NdeII	GATC	1 cut(s)	64
NmuCI	GTSAC	1 cut(s)	267
PciSI	GCTCTTC	2 cut(s)	327, 366
PfeI	GAWTC	2 cut(s)	236, 356
PkrI	GCNGC	2 cut(s)	123, 149
PleI	GAGTC	1 cut(s)	176
PpsI	GAGTC	1 cut(s)	176
PshAI	GACNNNNGTC	2 cut(s)	265, 346
Psp6I	CCWGG	1 cut(s)	362
PspGI	CCWGG	1 cut(s)	362
SapI	GCTCTTC	2 cut(s)	327, 366
SaqAI	TTAA	2 cut(s)	446, 460
SatI	GCNGC	2 cut(s)	122, 148
Sau3AI	GATC	1 cut(s)	64
SchI	GAGTC	1 cut(s)	176
ScrFI	CCNGG	1 cut(s)	364
SetI	ASST	5 cut(s)	10, 85, 115, 350, 446
Sse9I	AATT	3 cut(s)	423, 447, 457
SsiI	CCGC	3 cut(s)	44, 122, 148
SspMI	CTAG	1 cut(s)	351
StyD4I	CCNGG	1 cut(s)	362
TaaI	ACNGT	3 cut(s)	75, 264, 404
TaiI	ACGT	2 cut(s)	10, 115
TasI	AATT	3 cut(s)	423, 447, 457
TauI	GCSGC	2 cut(s)	124, 150
TfiI	GAWTC	2 cut(s)	236, 356
Tru1I	TTAA	2 cut(s)	446, 460
Tru9I	TTAA	2 cut(s)	446, 460
TseFI	GTSAC	1 cut(s)	267
Tsp45I	GTSAC	1 cut(s)	267
TspDTI	ATGAA	2 cut(s)	93, 300
TspGWI	ACGGA	1 cut(s)	123
XspI	CTAG	1 cut(s)	351
ZraI	GACGTC	1 cut(s)	113

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.