Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001879.1

Orthogroup ID

OG0005168

Physical Location & Seq

Genomic Coordinates Reverse (-)

156912 .. 158027

Gene Structure 1116 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001879.1_g000042.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1116 bp

atggggccggggagcgctgggaatccaccaccatactcatcaacacctccgcgtccacttgacctagatgaagtcaggaggaagatgatccaaatcgctagagaacaggcagctgaacaggcagctgcgtggcgccgggaactcgagaaaactatggcgtcgttccagtctgagttactaaacaagttgaggcaatttcgcttggagctcatagctcaggtgatggagtcgtcagtgccgactttgtccgttccaatcatatctcagccagtgactcagtctgtctcttcagggctgcaacttgggatcatcgattgttacaaaccgccgccaccaccaccggccacggcgaatccctacccgtacatctacgagcttcaacaacttccacctccgccgcctagaccatcagtcactgtccacacgttgggtgagccaccatccccagcccacatgaggtacacctaccactcagtctcatttggtgatttcaatcaaaatatgaggtacacctaccactcggtaaaaattggtgatttcaatcaaaatattaaccaggaacaacaatatttctctttgaatgatgattgtggtgctttgagtcctgtgtctgttgctaaattgactggtattgatgagaaattagatatgggagagggagataatgctgataagatggttaaggtgaatagtagggttggtagagacttcaatgagcttaagaatggcagttctgagcaggacgagggtggttctattgaagataaggagcagctgagcaatggaatgttagaatatcatgccctccaattgttcgataaaatgccaaagtcagaagggcggtgtaatgcaggaaggaccattattgcttctatgggcattcaaaacaaaggtggaggactcgctactcattgtgaaattgttgacgcttctgactatttaggccttcctaaagcacgttcccaggtccattatactgtccgccttgctactgtagaggtgttagctgctgctttaaaaaaaatctgtagatcaaggctatgcagctgtacaacaaccaatacctgctgcaagcccaattggaatgctaaacgtgatgcctcagatgtcaattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

371

Amino Acids

40.88

Weight (kDa)

6.41

Isoelectric Point (pI)

51.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005168)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g22470
rosa_chinensis	RchiOBHm_Chr4g0385821 RchiOBHm_Chr4g0393181 RchiOBHm_Chr4g0393191 RchiOBHm_Chr6g0274801 RchiOBHm_Chr7g0189981 RchiOBHm_Chr7g0189991
rosa_laevigata	RLG00000004572
rosa_multiflora	Rmu_sc0000365.1_g000052 Rmu_sc0000365.1_g000053 Rmu_sc0000827.1_g000018 Rmu_sc0001251.1_g000022 Rmu_sc0001266.1_g000003 Rmu_sc0001879.1_g000042 Rmu_sc0003069.1_g000022 Rmu_sc0004886.1_g000002 Rmu_sc0005120.1_g000011 Rmu_sc0005120.1_g000012 Rmu_sc0006153.1_g000015 Rmu_sc0014668.1_g000003
rosa_roxburghii	Rroxscaffold_1G00049180 Rroxscaffold_3G00241490 Rroxscaffold_3G00262780 Rroxscaffold_4G00276460 Rroxscaffold_4G00302780 Rroxscaffold_5G00359090 Rroxscaffold_5G00369400 Rroxscaffold_7G00165260
rosa_samantha	Rh6AG039900 Rh7CG111700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	1073
AccB1I	GGYRCC	1 cut(s)	132
AccB7I	CCANNNNNTGG	1 cut(s)	427
AccII	CGCG	1 cut(s)	52
AciI	CCGC	7 cut(s)	50, 326, 329, 395, 398, 841, 982
AclWI	GGATC	2 cut(s)	82, 314
AcoI	YGGCCR	1 cut(s)	342
AcuI	CTGAAG	1 cut(s)	273
AcyI	GRCGYC	2 cut(s)	133, 158
AfaI	GTAC	4 cut(s)	365, 461, 509, 1051
AfeI	AGCGCT	1 cut(s)	16
AfiI	CCNNNNNNNGG	2 cut(s)	427, 456
AflII	CTTAAG	1 cut(s)	719
AflIII	ACRYGT	1 cut(s)	423
AgsI	TTSAA	7 cut(s)	380, 493, 541, 580, 712, 761, 884
AhdI	GACNNNNNGTC	1 cut(s)	410
AjnI	CCWGG	2 cut(s)	555, 963
AluBI	AGCT	9 cut(s)	113, 125, 208, 215, 376, 718, 775, 1007, 1047
AluI	AGCT	9 cut(s)	113, 125, 208, 215, 376, 718, 775, 1007, 1047
Alw21I	GWGCWC	1 cut(s)	210
Alw26I	GTCTC	3 cut(s)	289, 481, 699
AlwI	GGATC	2 cut(s)	82, 314
AlwNI	CAGNNNCTG	1 cut(s)	416
Ama87I	CYCGRG	1 cut(s)	143
Aor51HI	AGCGCT	1 cut(s)	16
AoxI	GGCC	3 cut(s)	5, 342, 943
ApeKI	GCWGC	9 cut(s)	110, 122, 125, 295, 772, 1007, 1010, 1044, 1068
AspLEI	GCGC	2 cut(s)	17, 135
AspS9I	GGNCC	3 cut(s)	5, 858, 967
AsuC2I	CCSGG	2 cut(s)	9, 137
AsuHPI	GGTGA	5 cut(s)	232, 443, 497, 545, 697
AvaI	CYCGRG	1 cut(s)	143
AvaII	GGWCC	2 cut(s)	858, 967
BanI	GGYRCC	1 cut(s)	132
BanII	GRGCYC	1 cut(s)	210
Bbv12I	GWGCWC	1 cut(s)	210
BbvI	GCAGC	9 cut(s)	112, 122, 134, 282, 784, 994, 997, 1055, 1056
BccI	CCATC	4 cut(s)	217, 415, 448, 670
BceAI	ACGGC	1 cut(s)	363
BciT130I	CCWGG	2 cut(s)	557, 965
BcnI	CCSGG	2 cut(s)	9, 137
BcoDI	GTCTC	3 cut(s)	289, 481, 699
BfaI	CTAG	3 cut(s)	65, 99, 402
BfmI	CTRYAG	2 cut(s)	993, 1027
BfoI	RGCGCY	2 cut(s)	18, 136
BfrI	CTTAAG	1 cut(s)	719
BfuAI	ACCTGC	1 cut(s)	1073
BlpI	GCTNAGC	1 cut(s)	776
Bme1390I	CCNGG	4 cut(s)	9, 137, 557, 965
Bme18I	GGWCC	2 cut(s)	858, 967
BmeRI	GACNNNNNGTC	1 cut(s)	410
BmeT110I	CYCGRG	1 cut(s)	143
BmgT120I	GGNCC	3 cut(s)	5, 858, 967
BmiI	GGNNCC	2 cut(s)	6, 134
BmrFI	CCNGG	4 cut(s)	9, 137, 557, 965
BmsI	GCATC	1 cut(s)	1087
Bpu10I	CCTNAGC	1 cut(s)	216
Bpu1102I	GCTNAGC	1 cut(s)	776
BpuMI	CCSGG	2 cut(s)	9, 137
Bsa29I	ATCGAT	1 cut(s)	312
BsaBI	GATNNNNATC	3 cut(s)	92, 492, 540
BsaHI	GRCGYC	2 cut(s)	133, 158
BsaJI	CCNNGG	3 cut(s)	8, 345, 963
Bsc4I	CCNNNNNNNGG	2 cut(s)	427, 456
Bse118I	RCCGGY	1 cut(s)	340
Bse1I	ACTGG	3 cut(s)	166, 269, 631
Bse3DI	GCAATG	1 cut(s)	787
Bse8I	GATNNNNATC	3 cut(s)	92, 492, 540
BseBI	CCWGG	2 cut(s)	557, 965
BseCI	ATCGAT	1 cut(s)	312
BseDI	CCNNGG	3 cut(s)	8, 345, 963
BseGI	GGATG	1 cut(s)	440
BseJI	GATNNNNATC	3 cut(s)	92, 492, 540
BseLI	CCNNNNNNNGG	2 cut(s)	427, 456
BseMI	GCAATG	1 cut(s)	787
BseMII	CTCAG	8 cut(s)	162, 230, 278, 290, 486, 726, 767, 1116
BseNI	ACTGG	3 cut(s)	166, 269, 631
BseXI	GCAGC	9 cut(s)	112, 122, 134, 282, 784, 994, 997, 1055, 1056
BseYI	CCCAGC	2 cut(s)	17, 445
Bsh1236I	CGCG	1 cut(s)	52
BshFI	GGCC	3 cut(s)	7, 344, 945
BshNI	GGYRCC	1 cut(s)	132
BshVI	ATCGAT	1 cut(s)	312
BsiHKAI	GWGCWC	1 cut(s)	210
BsiHKCI	CYCGRG	1 cut(s)	143
BsiSI	CCGG	3 cut(s)	8, 136, 341
BslI	CCNNNNNNNGG	2 cut(s)	427, 456
BsmAI	GTCTC	3 cut(s)	289, 481, 699
BsmI	GAATGC	2 cut(s)	879, 1090
BsnI	GGCC	3 cut(s)	7, 344, 945
BsoBI	CYCGRG	1 cut(s)	143
Bsp1286I	GDGCHC	1 cut(s)	210
Bsp1407I	TGTACA	1 cut(s)	1049
Bsp143I	GATC	3 cut(s)	87, 306, 1031
Bsp1720I	GCTNAGC	1 cut(s)	776
BspACI	CCGC	7 cut(s)	50, 326, 329, 395, 398, 841, 982
BspANI	GGCC	3 cut(s)	7, 344, 945
BspCNI	CTCAG	8 cut(s)	163, 229, 277, 289, 485, 727, 768, 1115
BspDI	ATCGAT	1 cut(s)	312
BspFNI	CGCG	1 cut(s)	52
BspLI	GGNNCC	2 cut(s)	6, 134
BspMI	ACCTGC	1 cut(s)	1073
BspPI	GGATC	2 cut(s)	82, 314
BspT107I	GGYRCC	1 cut(s)	132
BspTI	CTTAAG	1 cut(s)	719
BsrDI	GCAATG	1 cut(s)	787
BsrFI	RCCGGY	1 cut(s)	340
BsrGI	TGTACA	1 cut(s)	1049
BsrI	ACTGG	3 cut(s)	166, 269, 631
BssAI	RCCGGY	1 cut(s)	340
BssECI	CCNNGG	3 cut(s)	8, 345, 963
BssMI	GATC	3 cut(s)	87, 306, 1031
BssNI	GRCGYC	2 cut(s)	133, 158
Bst2UI	CCWGG	2 cut(s)	557, 965
Bst4CI	ACNGT	3 cut(s)	418, 979, 994
Bst6I	CTCTTC	1 cut(s)	292
BstACI	GRCGYC	2 cut(s)	133, 158
BstAFI	CTTAAG	1 cut(s)	719
BstAUI	TGTACA	1 cut(s)	1049
BstC8I	GCNNGC	1 cut(s)	1073
BstDEI	CTNAG	8 cut(s)	171, 216, 264, 276, 472, 735, 776, 1102
BstDSI	CCRYGG	1 cut(s)	345
BstF5I	GGATG	1 cut(s)	440
BstFNI	CGCG	1 cut(s)	52
BstH2I	RGCGCY	2 cut(s)	18, 136
BstHHI	GCGC	2 cut(s)	17, 135
BstKTI	GATC	3 cut(s)	90, 309, 1034
BstMAI	GTCTC	3 cut(s)	289, 481, 699
BstMBI	GATC	3 cut(s)	87, 306, 1031
BstMWI	GCNNNNNNNGC	1 cut(s)	119
BstNI	CCWGG	2 cut(s)	557, 965
BstSCI	CCNGG	4 cut(s)	7, 135, 555, 963
BstSFI	CTRYAG	2 cut(s)	993, 1027
BstUI	CGCG	1 cut(s)	52
BstV1I	GCAGC	9 cut(s)	112, 122, 134, 282, 784, 994, 997, 1055, 1056
Bsu15I	ATCGAT	1 cut(s)	312
BsuRI	GGCC	3 cut(s)	7, 344, 945
BsuTUI	ATCGAT	1 cut(s)	312
BtgI	CCRYGG	1 cut(s)	345
BtsCI	GGATG	1 cut(s)	440
BtsIMutI	CAGTG	3 cut(s)	240, 276, 414
BveI	ACCTGC	1 cut(s)	1073
Cac8I	GCNNGC	1 cut(s)	1073
CaiI	CAGNNNCTG	1 cut(s)	416
CfoI	GCGC	2 cut(s)	17, 135
Cfr10I	RCCGGY	1 cut(s)	340
Cfr13I	GGNCC	3 cut(s)	5, 858, 967
ClaI	ATCGAT	1 cut(s)	312
CseI	GACGC	3 cut(s)	41, 147, 935
Csp6I	GTAC	4 cut(s)	364, 460, 508, 1050
CviAII	CATG	2 cut(s)	454, 800
CviQI	GTAC	4 cut(s)	364, 460, 508, 1050
DdeI	CTNAG	8 cut(s)	171, 216, 264, 276, 472, 735, 776, 1102
DinI	GGCGCC	1 cut(s)	134
DpnI	GATC	3 cut(s)	89, 308, 1033
DpnII	GATC	3 cut(s)	87, 306, 1031
DraI	TTTAAA	1 cut(s)	1017
DriI	GACNNNNNGTC	1 cut(s)	410
EaeI	YGGCCR	1 cut(s)	342
Eam1104I	CTCTTC	1 cut(s)	292
Eam1105I	GACNNNNNGTC	1 cut(s)	410
EarI	CTCTTC	1 cut(s)	292
EciI	GGCGGA	2 cut(s)	384, 971
Ecl136II	GAGCTC	1 cut(s)	208
Eco147I	AGGCCT	1 cut(s)	945
Eco24I	GRGCYC	1 cut(s)	210
Eco47I	GGWCC	2 cut(s)	858, 967
Eco47III	AGCGCT	1 cut(s)	16
Eco53kI	GAGCTC	1 cut(s)	208
Eco57I	CTGAAG	1 cut(s)	273
Eco88I	CYCGRG	1 cut(s)	143
EcoICRI	GAGCTC	1 cut(s)	208
EcoRII	CCWGG	2 cut(s)	555, 963
EcoT38I	GRGCYC	1 cut(s)	210
EgeI	GGCGCC	1 cut(s)	134
EheI	GGCGCC	1 cut(s)	134
FaeI	CATG	2 cut(s)	457, 803
FatI	CATG	2 cut(s)	453, 799
FokI	GGATG	1 cut(s)	427
FriOI	GRGCYC	1 cut(s)	210
FspBI	CTAG	3 cut(s)	65, 99, 402
GlaI	GCGC	2 cut(s)	16, 134
GsaI	CCCAGC	2 cut(s)	21, 449
HaeII	RGCGCY	2 cut(s)	18, 136
HaeIII	GGCC	3 cut(s)	7, 344, 945
HapII	CCGG	3 cut(s)	8, 136, 341
HgaI	GACGC	3 cut(s)	41, 147, 935
HhaI	GCGC	2 cut(s)	17, 135
Hin1I	GRCGYC	2 cut(s)	133, 158
Hin1II	CATG	2 cut(s)	457, 803
Hin6I	GCGC	2 cut(s)	15, 133
HinP1I	GCGC	2 cut(s)	15, 133
HincII	GTYRAC	1 cut(s)	925
HindII	GTYRAC	1 cut(s)	925
HinfI	GANTC	6 cut(s)	22, 227, 274, 352, 601, 900
HpaII	CCGG	3 cut(s)	8, 136, 341
HphI	GGTGA	5 cut(s)	232, 443, 497, 545, 697
Hpy166II	GTNNAC	5 cut(s)	56, 421, 462, 510, 925
Hpy188I	TCNGA	5 cut(s)	172, 736, 835, 934, 1105
Hpy188III	TCNNGA	2 cut(s)	76, 145
Hpy8I	GTNNAC	5 cut(s)	56, 421, 462, 510, 925
Hpy99I	CGWCG	1 cut(s)	163
HpyAV	CCTTC	3 cut(s)	830, 849, 956
HpyCH4III	ACNGT	3 cut(s)	418, 979, 994
HpyCH4IV	ACGT	3 cut(s)	425, 958, 1093
HpyCH4V	TGCA	4 cut(s)	298, 851, 1044, 1071
HpyF10VI	GCNNNNNNNGC	1 cut(s)	119
HpyF3I	CTNAG	8 cut(s)	171, 216, 264, 276, 472, 735, 776, 1102
HpySE526I	ACGT	3 cut(s)	425, 958, 1093
Hsp92I	GRCGYC	2 cut(s)	133, 158
Hsp92II	CATG	2 cut(s)	457, 803
HspAI	GCGC	2 cut(s)	15, 133
KasI	GGCGCC	1 cut(s)	132
Kzo9I	GATC	3 cut(s)	87, 306, 1031
LmnI	GCTCC	3 cut(s)	12, 205, 769
Lsp1109I	GCAGC	9 cut(s)	112, 122, 134, 282, 784, 994, 997, 1055, 1056
LweI	GCATC	1 cut(s)	1087
MaeI	CTAG	3 cut(s)	65, 99, 402
MaeII	ACGT	3 cut(s)	425, 958, 1093
MaeIII	GTNAC	4 cut(s)	174, 271, 317, 412
MalI	GATC	3 cut(s)	89, 308, 1033
MboI	GATC	3 cut(s)	87, 306, 1031
MboII	GAAGA	3 cut(s)	94, 279, 773
MfeI	CAATTG	3 cut(s)	809, 1078, 1111
MhlI	GDGCHC	1 cut(s)	210
MluCI	AATT	8 cut(s)	194, 528, 620, 641, 809, 918, 1078, 1111
Mly113I	GGCGCC	1 cut(s)	133
MlyI	GAGTC	4 cut(s)	236, 268, 610, 894
MseI	TTAA	4 cut(s)	552, 681, 720, 1016
MspA1I	CMGCKG	4 cut(s)	113, 125, 775, 1047
MspCI	CTTAAG	1 cut(s)	719
MspI	CCGG	3 cut(s)	8, 136, 341
MspR9I	CCNGG	4 cut(s)	9, 137, 557, 965
MunI	CAATTG	3 cut(s)	809, 1078, 1111
Mva1269I	GAATGC	2 cut(s)	879, 1090
MvaI	CCWGG	2 cut(s)	557, 965
MvnI	CGCG	1 cut(s)	52
MwoI	GCNNNNNNNGC	1 cut(s)	119
NarI	GGCGCC	1 cut(s)	133
NciI	CCSGG	2 cut(s)	9, 137
NdeII	GATC	3 cut(s)	87, 306, 1031
NlaIII	CATG	2 cut(s)	457, 803
NlaIV	GGNNCC	2 cut(s)	6, 134
NmuCI	GTSAC	2 cut(s)	271, 412
PaeR7I	CTCGAG	1 cut(s)	143
PceI	AGGCCT	1 cut(s)	945
PcsI	WCGNNNNNNNCGW	1 cut(s)	236
PctI	GAATGC	2 cut(s)	879, 1090
PfeI	GAWTC	2 cut(s)	22, 352
PflFI	GACNNNGTC	2 cut(s)	244, 277
PflMI	CCANNNNNTGG	1 cut(s)	427
PleI	GAGTC	4 cut(s)	235, 268, 609, 894
PluTI	GGCGCC	1 cut(s)	136
PpsI	GAGTC	4 cut(s)	235, 268, 609, 894
Psp124BI	GAGCTC	1 cut(s)	210
Psp6I	CCWGG	2 cut(s)	555, 963
PspFI	CCCAGC	2 cut(s)	17, 445
PspGI	CCWGG	2 cut(s)	555, 963
PspN4I	GGNNCC	2 cut(s)	6, 134
PspPI	GGNCC	3 cut(s)	5, 858, 967
PstNI	CAGNNNCTG	1 cut(s)	416
PsyI	GACNNNGTC	2 cut(s)	244, 277
PvuII	CAGCTG	4 cut(s)	113, 125, 775, 1047
RsaI	GTAC	4 cut(s)	365, 461, 509, 1051
RsaNI	GTAC	4 cut(s)	364, 460, 508, 1050
SacI	GAGCTC	1 cut(s)	210
SaqAI	TTAA	4 cut(s)	552, 681, 720, 1016
Sau3AI	GATC	3 cut(s)	87, 306, 1031
Sau96I	GGNCC	3 cut(s)	5, 858, 967
SchI	GAGTC	4 cut(s)	236, 268, 610, 894
ScrFI	CCNGG	4 cut(s)	9, 137, 557, 965
SduI	GDGCHC	1 cut(s)	210
SfaNI	GCATC	1 cut(s)	1087
SfcI	CTRYAG	2 cut(s)	993, 1027
SfoI	GGCGCC	1 cut(s)	134
Sfr274I	CTCGAG	1 cut(s)	143
SinI	GGWCC	2 cut(s)	858, 967
SlaI	CTCGAG	1 cut(s)	143
SmlI	CTYRAG	2 cut(s)	143, 719
SmoI	CTYRAG	2 cut(s)	143, 719
Sse9I	AATT	8 cut(s)	194, 528, 620, 641, 809, 918, 1078, 1111
SseBI	AGGCCT	1 cut(s)	945
SsiI	CCGC	7 cut(s)	50, 326, 329, 395, 398, 841, 982
SspDI	GGCGCC	1 cut(s)	132
SspI	AATATT	2 cut(s)	550, 569
SspMI	CTAG	3 cut(s)	65, 99, 402
SstI	GAGCTC	1 cut(s)	210
StuI	AGGCCT	1 cut(s)	945
StyD4I	CCNGG	4 cut(s)	7, 135, 555, 963
TaaI	ACNGT	3 cut(s)	418, 979, 994
TaiI	ACGT	3 cut(s)	428, 961, 1096
TaqI	TCGA	3 cut(s)	144, 312, 816
TasI	AATT	8 cut(s)	194, 528, 620, 641, 809, 918, 1078, 1111
TatI	WGTACW	1 cut(s)	1049
TauI	GCSGC	2 cut(s)	331, 400
TfiI	GAWTC	2 cut(s)	22, 352
Tru1I	TTAA	4 cut(s)	552, 681, 720, 1016
Tru9I	TTAA	4 cut(s)	552, 681, 720, 1016
TscAI	CASTG	3 cut(s)	240, 276, 421
TseFI	GTSAC	2 cut(s)	271, 412
TseI	GCWGC	9 cut(s)	110, 122, 125, 295, 772, 1007, 1010, 1044, 1068
Tsp45I	GTSAC	2 cut(s)	271, 412
TspDTI	ATGAA	1 cut(s)	84
TspGWI	ACGGA	1 cut(s)	238
TspRI	CASTG	3 cut(s)	240, 276, 421
Tth111I	GACNNNGTC	2 cut(s)	244, 277
Van91I	CCANNNNNTGG	1 cut(s)	427
Vha464I	CTTAAG	1 cut(s)	719
VpaK11BI	GGWCC	2 cut(s)	858, 967
XhoI	CTCGAG	1 cut(s)	143
XspI	CTAG	3 cut(s)	65, 99, 402

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.