Rmu_sc0005120.1_g000012

Domain of unknown function (DUF3444)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005120.1
Physical Location & Seq
Forward (+)
54905 .. 56419
1515 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005120.1_g000012.1.cds

Sequence Viewer

Length: 1515 bp
atgaagcgaaaacccttgtctaagtccgctcgacgcagtcgaaaacgaattcagggcgattcagagattgacaggtgtgaccctcttttgattacgtccacaaaacccgatgatttggatgtgccagttgagacatctcctgctttcacaactgtactgatggttgcagctgtgattgagaagcaagatttgagtgttcctttgattaaggatgagtccatgcttgttgagagtaagaaactatttgtgctcggtgctgtagacttgactaaggtcatgcattccaaggttaatggttcatatcatgaatctgattcgagctatcaagctccctctcccacatctgatgagatagagacaccaaagggtcgagaattggctttggatgggctttgggatgctagtggtggatttaacaccaagaagactaaattcaagagtttctcccttggagactttgagctaattcatgatgaagaccacatgcttgaagatcatgagcaaagtgcaattgtgactcagtttacccaattgtgccagcaggctggcggtaaggtacacatggttaccggagacttgcttatgctggctcatcctttacatttcaagcttattaatggtgacaattctaatgttacttttttggagaatatcaagtacaaatactgtaattgtgatattgttggtgttgaggaggatacacaattttataatttcaaaaaagataggaggagttttacgaaagggcagatgtgggctatatatgttgatgatggaatgccgagaaattatggtttggttgatgaagttttttatgtcagtccttttgagatggaaattagttggttggatcttcagaataatgggaatcagtggttggcttcttgggagaagatgggcttgcatgttccttgtggaaggtttaaagttactaaggagaccacctctaattcagtccatataatttctcatgtgatggaatgtgacaaggctgcaagagagatttatctgatttatccaaagaagggatttgtttgggcactttgtaatgaaacagcttttgacactgatggaagaaatatgttggttaaagagaagcgatgctatgacatagttgtgttccagacaagttatactgagatgcacggtttgagtatgggttatcttgatgtaattttagcaattaagaagtatttgagtgatacaattgagccttggttggatgggacttttagtgggaatgatgatttcaagtctgcattagttatcacagatgatactggaggttacccttatctaattgacgtggctgtacttcatttcccttgccaaactaaatctctctgccacccaaggagggattttgttgataacgtcattgattttctcaaaagcaattccaagttatcttttctgaggtactcttctgatctacttctttcaagagataattgtataagctttgtgactaaaatgcacaagtttttttcaatacatggtgggacattttcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

504

Amino Acids

57.28

Weight (kDa)

5.69

Isoelectric Point (pI)

38.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 711
AccBSI CCGCTC 1 cut(s) 29
AccI GTMKAC 1 cut(s) 261
AciI CCGC 2 cut(s) 27, 549
AclWI GGATC 1 cut(s) 858
AcsI RAATTY 2 cut(s) 48, 431
AcuI CTGAAG 1 cut(s) 839
AfaI GTAC 5 cut(s) 156, 558, 659, 1314, 1421
AfiI CCNNNNNNNGG 2 cut(s) 1025, 1357
AgsI TTSAA 7 cut(s) 436, 491, 607, 718, 1252, 1443, 1491
AjiI CACGTC 1 cut(s) 1306
AjuI GAANNNNNNNTTGG 2 cut(s) 860, 892
AluBI AGCT 7 cut(s) 170, 321, 329, 463, 610, 1058, 1461
AluI AGCT 7 cut(s) 170, 321, 329, 463, 610, 1058, 1461
Alw21I GWGCWC 1 cut(s) 252
Alw26I GTCTC 5 cut(s) 125, 350, 447, 567, 932
AlwI GGATC 1 cut(s) 858
ApeKI GCWGC 2 cut(s) 167, 992
ApoI RAATTY 2 cut(s) 48, 431
AseI ATTAAT 1 cut(s) 615
AsuHPI GGTGA 1 cut(s) 632
BaeGI GKGCMC 1 cut(s) 1042
BbsI GAAGAC 2 cut(s) 431, 483
Bbv12I GWGCWC 1 cut(s) 252
BbvI GCAGC 2 cut(s) 179, 979
BccI CCATC 8 cut(s) 154, 380, 767, 826, 889, 970, 1064, 1217
BciVI GTATCC 1 cut(s) 691
BcoDI GTCTC 5 cut(s) 125, 350, 447, 567, 932
BfaI CTAG 1 cut(s) 402
BfmI CTRYAG 1 cut(s) 258
BfuI GTATCC 1 cut(s) 691
BisI GCNGC 2 cut(s) 168, 993
BlsI GCNGC 2 cut(s) 169, 994
BmgBI CACGTC 1 cut(s) 1306
BmsI GCATC 3 cut(s) 388, 1091, 1131
BoxI GACNNNNGTC 1 cut(s) 272
BpiI GAAGAC 2 cut(s) 431, 483
BplI GAGNNNNNCTC 2 cut(s) 929, 961
BpmI CTGGAG 1 cut(s) 1302
BsaI GGTCTC 1 cut(s) 932
BsaJI CCNNGG 4 cut(s) 285, 448, 1214, 1352
BsaWI WCCGGW 1 cut(s) 569
Bsc4I CCNNNNNNNGG 2 cut(s) 1025, 1357
Bse1I ACTGG 2 cut(s) 125, 1285
BseDI CCNNGG 4 cut(s) 285, 448, 1214, 1352
BseGI GGATG 6 cut(s) 124, 217, 391, 403, 592, 1228
BseLI CCNNNNNNNGG 2 cut(s) 1025, 1357
BseMII CTCAG 3 cut(s) 533, 1128, 1406
BseNI ACTGG 2 cut(s) 125, 1285
BseRI GAGGAG 2 cut(s) 707, 745
BseSI GKGCMC 1 cut(s) 1042
BseXI GCAGC 2 cut(s) 179, 979
BsiHKAI GWGCWC 1 cut(s) 252
BsiSI CCGG 1 cut(s) 570
BslFI GGGAC 1 cut(s) 1240
BslI CCNNNNNNNGG 2 cut(s) 1025, 1357
BsmAI GTCTC 5 cut(s) 125, 350, 447, 567, 932
BsmFI GGGAC 1 cut(s) 1240
BsmI GAATGC 2 cut(s) 280, 783
Bso31I GGTCTC 1 cut(s) 932
Bsp1286I GDGCHC 2 cut(s) 252, 1042
Bsp143I GATC 3 cut(s) 493, 850, 1429
BspACI CCGC 2 cut(s) 27, 549
BspCNI CTCAG 3 cut(s) 532, 1129, 1407
BspHI TCATGA 3 cut(s) 304, 469, 496
BspPI GGATC 1 cut(s) 858
BspTNI GGTCTC 1 cut(s) 932
BsrBI CCGCTC 1 cut(s) 29
BsrI ACTGG 2 cut(s) 125, 1285
BssECI CCNNGG 4 cut(s) 285, 448, 1214, 1352
BssMI GATC 3 cut(s) 493, 850, 1429
BssT1I CCWWGG 4 cut(s) 285, 448, 1214, 1352
Bst4CI ACNGT 3 cut(s) 154, 668, 1148
Bst6I CTCTTC 1 cut(s) 1429
BstC8I GCNNGC 5 cut(s) 539, 543, 547, 588, 902
BstDEI CTNAG 6 cut(s) 21, 270, 519, 933, 1137, 1415
BstEII GGTNACC 2 cut(s) 565, 1286
BstF5I GGATG 6 cut(s) 124, 217, 391, 403, 592, 1228
BstKTI GATC 3 cut(s) 496, 853, 1432
BstMAI GTCTC 5 cut(s) 125, 350, 447, 567, 932
BstMBI GATC 3 cut(s) 493, 850, 1429
BstNSI RCATGY 2 cut(s) 487, 908
BstPAI GACNNNNGTC 1 cut(s) 272
BstPI GGTNACC 2 cut(s) 565, 1286
BstSFI CTRYAG 1 cut(s) 258
BstSLI GKGCMC 1 cut(s) 1042
BstV1I GCAGC 2 cut(s) 179, 979
BstV2I GAAGAC 2 cut(s) 431, 483
BstX2I RGATCY 1 cut(s) 850
BstXI CCANNNNNNTGG 1 cut(s) 545
BstYI RGATCY 1 cut(s) 850
BsuI GTATCC 1 cut(s) 691
BtgZI GCGATG 1 cut(s) 1114
BtrI CACGTC 1 cut(s) 1306
BtsCI GGATG 6 cut(s) 124, 217, 391, 403, 592, 1228
BtsIMutI CAGTG 2 cut(s) 878, 1065
Cac8I GCNNGC 5 cut(s) 539, 543, 547, 588, 902
CciI TCATGA 3 cut(s) 304, 469, 496
CseI GACGC 1 cut(s) 42
Csp6I GTAC 5 cut(s) 155, 557, 658, 1313, 1420
CviQI GTAC 5 cut(s) 155, 557, 658, 1313, 1420
DdeI CTNAG 6 cut(s) 21, 270, 519, 933, 1137, 1415
DpnI GATC 3 cut(s) 495, 852, 1431
DpnII GATC 3 cut(s) 493, 850, 1429
DraI TTTAAA 1 cut(s) 925
Eam1104I CTCTTC 1 cut(s) 1429
EarI CTCTTC 1 cut(s) 1429
Eco130I CCWWGG 4 cut(s) 285, 448, 1214, 1352
Eco31I GGTCTC 1 cut(s) 932
Eco57I CTGAAG 1 cut(s) 839
Eco91I GGTNACC 2 cut(s) 565, 1286
EcoO65I GGTNACC 2 cut(s) 565, 1286
EcoRI GAATTC 1 cut(s) 48
EcoT14I CCWWGG 4 cut(s) 285, 448, 1214, 1352
EcoT22I ATGCAT 1 cut(s) 282
ErhI CCWWGG 4 cut(s) 285, 448, 1214, 1352
FalI AAGNNNNNCTT 2 cut(s) 884, 916
FaqI GGGAC 1 cut(s) 1240
FblI GTMKAC 1 cut(s) 261
Fnu4HI GCNGC 2 cut(s) 168, 993
FokI GGATG 6 cut(s) 131, 224, 398, 410, 579, 1235
Fsp4HI GCNGC 2 cut(s) 168, 993
FspBI CTAG 1 cut(s) 402
GluI GCNGC 2 cut(s) 168, 993
GsuI CTGGAG 1 cut(s) 1302
HapII CCGG 1 cut(s) 570
HgaI GACGC 1 cut(s) 42
HindIII AAGCTT 2 cut(s) 608, 1459
HinfI GANTC 6 cut(s) 59, 215, 308, 314, 517, 868
HpaII CCGG 1 cut(s) 570
HphI GGTGA 1 cut(s) 632
Hpy166II GTNNAC 4 cut(s) 99, 262, 525, 559
Hpy188I TCNGA 7 cut(s) 64, 313, 346, 858, 1011, 1416, 1429
Hpy188III TCNNGA 8 cut(s) 305, 371, 436, 470, 497, 1123, 1166, 1443
Hpy8I GTNNAC 4 cut(s) 99, 262, 525, 559
Hpy99I CGWCG 1 cut(s) 36
HpyAV CCTTC 2 cut(s) 912, 1018
HpyCH4III ACNGT 3 cut(s) 154, 668, 1148
HpyCH4IV ACGT 3 cut(s) 95, 1305, 1374
HpyCH4V TGCA 8 cut(s) 167, 280, 509, 904, 995, 1144, 1259, 1477
HpyF3I CTNAG 6 cut(s) 21, 270, 519, 933, 1137, 1415
HpySE526I ACGT 3 cut(s) 95, 1305, 1374
Kzo9I GATC 3 cut(s) 493, 850, 1429
LmnI GCTCC 1 cut(s) 334
Lsp1109I GCAGC 2 cut(s) 179, 979
LweI GCATC 3 cut(s) 388, 1091, 1131
MaeI CTAG 1 cut(s) 402
MaeII ACGT 3 cut(s) 95, 1305, 1374
MaeIII GTNAC 9 cut(s) 77, 514, 565, 620, 634, 928, 983, 1286, 1465
MalI GATC 3 cut(s) 495, 852, 1431
MbiI CCGCTC 1 cut(s) 29
MboI GATC 3 cut(s) 493, 850, 1429
MboII GAAGA 7 cut(s) 436, 488, 503, 845, 904, 1086, 1416
MfeI CAATTG 3 cut(s) 510, 530, 1206
MflI RGATCY 1 cut(s) 850
MhlI GDGCHC 2 cut(s) 252, 1042
MlyI GAGTC 2 cut(s) 224, 511
MmeI TCCRAC 2 cut(s) 828, 1200
MnlI CCTC 9 cut(s) 93, 343, 685, 688, 723, 955, 1277, 1350, 1410
Mph1103I ATGCAT 1 cut(s) 282
MseI TTAA 7 cut(s) 207, 291, 414, 615, 924, 1089, 1185
MslI CAYNNNNRTG 1 cut(s) 1115
MspA1I CMGCKG 1 cut(s) 170
MspI CCGG 1 cut(s) 570
MunI CAATTG 3 cut(s) 510, 530, 1206
Mva1269I GAATGC 2 cut(s) 280, 783
NdeII GATC 3 cut(s) 493, 850, 1429
NmeAIII GCCGAG 1 cut(s) 807
NmuCI GTSAC 5 cut(s) 77, 514, 620, 983, 1465
NsiI ATGCAT 1 cut(s) 282
NspI RCATGY 2 cut(s) 487, 908
PagI TCATGA 3 cut(s) 304, 469, 496
PcsI WCGNNNNNNNCGW 1 cut(s) 37
PctI GAATGC 2 cut(s) 280, 783
PfeI GAWTC 4 cut(s) 59, 308, 314, 868
PflFI GACNNNGTC 1 cut(s) 36
PkrI GCNGC 2 cut(s) 169, 994
PleI GAGTC 2 cut(s) 223, 511
PpsI GAGTC 2 cut(s) 223, 511
PshAI GACNNNNGTC 1 cut(s) 272
PshBI ATTAAT 1 cut(s) 615
PsiI TTATAA 1 cut(s) 711
PspEI GGTNACC 2 cut(s) 565, 1286
PsuI RGATCY 1 cut(s) 850
PsyI GACNNNGTC 1 cut(s) 36
PvuII CAGCTG 1 cut(s) 170
RsaI GTAC 5 cut(s) 156, 558, 659, 1314, 1421
RsaNI GTAC 5 cut(s) 155, 557, 658, 1313, 1420
RseI CAYNNNNRTG 1 cut(s) 1115
SaqAI TTAA 7 cut(s) 207, 291, 414, 615, 924, 1089, 1185
SatI GCNGC 2 cut(s) 168, 993
Sau3AI GATC 3 cut(s) 493, 850, 1429
SchI GAGTC 2 cut(s) 224, 511
SduI GDGCHC 2 cut(s) 252, 1042
SfaNI GCATC 3 cut(s) 388, 1091, 1131
SfcI CTRYAG 1 cut(s) 258
SmiMI CAYNNNNRTG 1 cut(s) 1115
SsiI CCGC 2 cut(s) 27, 549
SspMI CTAG 1 cut(s) 402
StyI CCWWGG 4 cut(s) 285, 448, 1214, 1352
TaaI ACNGT 3 cut(s) 154, 668, 1148
TaiI ACGT 3 cut(s) 98, 1308, 1377
TaqI TCGA 4 cut(s) 31, 40, 317, 370
TatI WGTACW 3 cut(s) 154, 657, 1312
TfiI GAWTC 4 cut(s) 59, 308, 314, 868
Tru1I TTAA 7 cut(s) 207, 291, 414, 615, 924, 1089, 1185
Tru9I TTAA 7 cut(s) 207, 291, 414, 615, 924, 1089, 1185
TscAI CASTG 2 cut(s) 878, 1072
TseFI GTSAC 5 cut(s) 77, 514, 620, 983, 1465
TseI GCWGC 2 cut(s) 167, 992
Tsp45I GTSAC 5 cut(s) 77, 514, 620, 983, 1465
TspDTI ATGAA 9 cut(s) 17, 288, 321, 458, 489, 819, 1065, 1307, 1500
TspRI CASTG 2 cut(s) 878, 1072
Tth111I GACNNNGTC 1 cut(s) 36
VspI ATTAAT 1 cut(s) 615
XapI RAATTY 2 cut(s) 48, 431
XceI RCATGY 2 cut(s) 487, 908
XmiI GTMKAC 1 cut(s) 261
XspI CTAG 1 cut(s) 402
Zsp2I ATGCAT 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.