Rmu_sc0003861.1_g000004

Serine threonine-protein phosphatase 7 long form homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003861.1
Physical Location & Seq
Reverse (-)
14187 .. 15489
1303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003861.1_g000004.1.cds

Sequence Viewer

Length: 411 bp
atgatgtctccaacaccggataagaccggggcaagtgttgatgtgatgtttttggaattgttggaggacattgatagtatagggaagtttgaatggggtgcgactatgctagctcatctgcaagtagagctgcaaaaaattggatcaacttcattggctgggcataggtattctttgatggtagacctgtgcacgacgctacaaggccgagaagtcgcacggtggagctgcaaatctcccagatcggagatcacgtttacggccaccatagtcgatgatccttgggggcttttgaagcccagaggacgtagatactctccacaaaacagcttgcaacgatttgatctgtggagatcgaattttgaagtttttgaaactagggttcatcggatccgtcgacttccaaggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

15.68

Weight (kDa)

9.13

Isoelectric Point (pI)

50.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 183, 397
AclWI GGATC 4 cut(s) 151, 272, 385, 398
AcoI YGGCCR 1 cut(s) 261
AcsI RAATTY 1 cut(s) 358
AgsI TTSAA 4 cut(s) 92, 295, 365, 374
AluBI AGCT 4 cut(s) 113, 130, 228, 330
AluI AGCT 4 cut(s) 113, 130, 228, 330
Alw21I GWGCWC 1 cut(s) 194
Alw26I GTCTC 1 cut(s) 12
Alw44I GTGCAC 1 cut(s) 190
AlwI GGATC 4 cut(s) 151, 272, 385, 398
AoxI GGCC 2 cut(s) 205, 261
ApaLI GTGCAC 1 cut(s) 190
ApeKI GCWGC 2 cut(s) 130, 228
ApoI RAATTY 1 cut(s) 358
AsuC2I CCSGG 1 cut(s) 28
AsuNHI GCTAGC 1 cut(s) 109
BaeGI GKGCMC 1 cut(s) 194
BamHI GGATCC 1 cut(s) 390
Bbv12I GWGCWC 1 cut(s) 194
BbvI GCAGC 2 cut(s) 117, 215
BccI CCATC 1 cut(s) 172
BceAI ACGGC 1 cut(s) 276
BcnI CCSGG 1 cut(s) 28
BcoDI GTCTC 1 cut(s) 12
BfaI CTAG 2 cut(s) 110, 378
BisI GCNGC 2 cut(s) 131, 229
BlsI GCNGC 2 cut(s) 132, 230
Bme1390I CCNGG 1 cut(s) 28
BmiI GGNNCC 1 cut(s) 392
BmrFI CCNGG 1 cut(s) 28
BmtI GCTAGC 1 cut(s) 113
BpuMI CCSGG 1 cut(s) 28
BsaJI CCNNGG 3 cut(s) 27, 281, 404
BsaWI WCCGGW 1 cut(s) 16
BsaXI ACNNNNNCTCC 2 cut(s) 239, 269
BseDI CCNNGG 3 cut(s) 27, 281, 404
BseSI GKGCMC 1 cut(s) 194
BseXI GCAGC 2 cut(s) 117, 215
BseYI CCCAGC 1 cut(s) 158
BshFI GGCC 2 cut(s) 207, 263
BsiHKAI GWGCWC 1 cut(s) 194
BsiSI CCGG 2 cut(s) 17, 27
BsmAI GTCTC 1 cut(s) 12
BsnI GGCC 2 cut(s) 207, 263
Bsp1286I GDGCHC 1 cut(s) 194
Bsp143I GATC 7 cut(s) 143, 242, 249, 277, 343, 353, 390
BspANI GGCC 2 cut(s) 207, 263
BspLI GGNNCC 1 cut(s) 392
BspOI GCTAGC 1 cut(s) 113
BspPI GGATC 4 cut(s) 151, 272, 385, 398
BssECI CCNNGG 3 cut(s) 27, 281, 404
BssMI GATC 7 cut(s) 143, 242, 249, 277, 343, 353, 390
BssT1I CCWWGG 2 cut(s) 281, 404
Bst4CI ACNGT 1 cut(s) 222
BstC8I GCNNGC 2 cut(s) 111, 332
BstKTI GATC 7 cut(s) 146, 245, 252, 280, 346, 356, 393
BstMAI GTCTC 1 cut(s) 12
BstMBI GATC 7 cut(s) 143, 242, 249, 277, 343, 353, 390
BstMWI GCNNNNNNNGC 2 cut(s) 127, 295
BstSCI CCNGG 1 cut(s) 26
BstSLI GKGCMC 1 cut(s) 194
BstV1I GCAGC 2 cut(s) 117, 215
BstX2I RGATCY 1 cut(s) 390
BstYI RGATCY 1 cut(s) 390
BsuRI GGCC 2 cut(s) 207, 263
Cac8I GCNNGC 2 cut(s) 111, 332
CseI GACGC 1 cut(s) 205
CviJI RGCY 9 cut(s) 113, 130, 158, 207, 228, 263, 289, 298, 330
CviKI_1 RGCY 9 cut(s) 113, 130, 158, 207, 228, 263, 289, 298, 330
DpnI GATC 7 cut(s) 145, 244, 251, 279, 345, 355, 392
DpnII GATC 7 cut(s) 143, 242, 249, 277, 343, 353, 390
EaeI YGGCCR 1 cut(s) 261
Eco130I CCWWGG 2 cut(s) 281, 404
EcoT14I CCWWGG 2 cut(s) 281, 404
ErhI CCWWGG 2 cut(s) 281, 404
FaiI YATR 4 cut(s) 80, 107, 165, 269
FblI GTMKAC 2 cut(s) 183, 397
Fnu4HI GCNGC 2 cut(s) 131, 229
Fsp4HI GCNGC 2 cut(s) 131, 229
FspBI CTAG 2 cut(s) 110, 378
GluI GCNGC 2 cut(s) 131, 229
GsaI CCCAGC 1 cut(s) 162
HaeIII GGCC 2 cut(s) 207, 263
HapII CCGG 2 cut(s) 17, 27
HgaI GACGC 1 cut(s) 205
HincII GTYRAC 1 cut(s) 398
HindII GTYRAC 1 cut(s) 398
HpaII CCGG 2 cut(s) 17, 27
Hpy166II GTNNAC 4 cut(s) 184, 192, 258, 398
Hpy188I TCNGA 2 cut(s) 247, 390
Hpy8I GTNNAC 4 cut(s) 184, 192, 258, 398
Hpy99I CGWCG 2 cut(s) 199, 399
HpyCH4III ACNGT 1 cut(s) 222
HpyCH4IV ACGT 2 cut(s) 254, 307
HpyCH4V TGCA 5 cut(s) 121, 133, 192, 231, 334
HpyF10VI GCNNNNNNNGC 2 cut(s) 127, 295
HpySE526I ACGT 2 cut(s) 254, 307
Kzo9I GATC 7 cut(s) 143, 242, 249, 277, 343, 353, 390
LmnI GCTCC 1 cut(s) 225
LpnPI CCDG 6 cut(s) 30, 40, 144, 200, 253, 313
Lsp1109I GCAGC 2 cut(s) 117, 215
MaeI CTAG 2 cut(s) 110, 378
MaeII ACGT 2 cut(s) 254, 307
MalI GATC 7 cut(s) 145, 244, 251, 279, 345, 355, 392
MboI GATC 7 cut(s) 143, 242, 249, 277, 343, 353, 390
MflI RGATCY 1 cut(s) 390
MhlI GDGCHC 1 cut(s) 194
MluCI AATT 3 cut(s) 56, 138, 358
MmeI TCCRAC 2 cut(s) 35, 42
MnlI CCTC 2 cut(s) 58, 296
MspI CCGG 2 cut(s) 17, 27
MspR9I CCNGG 1 cut(s) 28
MwoI GCNNNNNNNGC 2 cut(s) 127, 295
NciI CCSGG 1 cut(s) 28
NdeII GATC 7 cut(s) 143, 242, 249, 277, 343, 353, 390
NheI GCTAGC 1 cut(s) 109
NlaIV GGNNCC 1 cut(s) 392
NmeAIII GCCGAG 1 cut(s) 233
PcsI WCGNNNNNNNCGW 2 cut(s) 251, 394
PkrI GCNGC 2 cut(s) 132, 230
PspFI CCCAGC 1 cut(s) 158
PspN4I GGNNCC 1 cut(s) 392
PsuI RGATCY 1 cut(s) 390
SalI GTCGAC 1 cut(s) 396
SatI GCNGC 2 cut(s) 131, 229
Sau3AI GATC 7 cut(s) 143, 242, 249, 277, 343, 353, 390
ScrFI CCNGG 1 cut(s) 28
SduI GDGCHC 1 cut(s) 194
SetI ASST 9 cut(s) 115, 132, 170, 189, 230, 257, 310, 332, 410
Sse9I AATT 3 cut(s) 56, 138, 358
SspMI CTAG 2 cut(s) 110, 378
StyD4I CCNGG 1 cut(s) 26
StyI CCWWGG 2 cut(s) 281, 404
TaaI ACNGT 1 cut(s) 222
TaiI ACGT 2 cut(s) 257, 310
TaqI TCGA 3 cut(s) 273, 356, 397
TasI AATT 3 cut(s) 56, 138, 358
TseI GCWGC 2 cut(s) 130, 228
TspDTI ATGAA 2 cut(s) 141, 374
TspGWI ACGGA 1 cut(s) 383
VneI GTGCAC 1 cut(s) 190
XapI RAATTY 1 cut(s) 358
XmiI GTMKAC 2 cut(s) 183, 397
XspI CTAG 2 cut(s) 110, 378
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.