Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0004553

Physical Location & Seq

Genomic Coordinates Reverse (-)

48386201 .. 48387075

Gene Structure 875 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00200910.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 198 bp

ATGAAAGTGAGAAAAGAACCGTGGAAGGAGCTAGGAGGCCGAGAAGCTGCACAGCTCGAGCTGGAATTCGCCCGATGCTGCTCGTCCTTCACCGGCCGATATCTCTCTCATCCGACCTCGAATCGAGTTGATTCCAAAAGGTATTTTTCTGGGCTTGAGGTATATTACAACTTTGTAGAAGACATCGAGGGGAAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

65

Amino Acids

7.61

Weight (kDa)

7.77

Isoelectric Point (pI)

24.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004553)

Species	Orthologous Gene IDs
pyrus_communis	pycom08g17200
rosa_chinensis	RchiOBHm_Chr2g0131311 RchiOBHm_Chr7g0219971
rosa_laevigata	RLG00000009451 RLG00000034059
rosa_multiflora	Rmu_sc0002758.1_g000005 Rmu_sc0003861.1_g000004 Rmu_sc0018646.1_g000002
rosa_roxburghii	Rroxscaffold_175G00432220 Rroxscaffold_1G00030210 Rroxscaffold_1G00033050 Rroxscaffold_1G00034250 Rroxscaffold_1G00039200 Rroxscaffold_2G00078570 Rroxscaffold_2G00089680 Rroxscaffold_2G00145370 Rroxscaffold_4G00308230 Rroxscaffold_4G00318460 Rroxscaffold_4G00321200 Rroxscaffold_4G00322640 Rroxscaffold_4G00325620 Rroxscaffold_4G00325790 Rroxscaffold_5G00344550 Rroxscaffold_5G00346240 Rroxscaffold_5G00356260 Rroxscaffold_5G00363420 Rroxscaffold_5G00376620 Rroxscaffold_7G00197800 Rroxscaffold_7G00198690 Rroxscaffold_7G00200910
rosa_samantha	Rh1CG272800 Rh5AG536300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	94
AcsI	RAATTY	1 cut(s)	65
AluBI	AGCT	4 cut(s)	31, 47, 55, 61
AluI	AGCT	4 cut(s)	31, 47, 55, 61
Ama87I	CYCGRG	1 cut(s)	56
AoxI	GGCC	2 cut(s)	37, 94
ApeKI	GCWGC	2 cut(s)	47, 78
ApoI	RAATTY	1 cut(s)	65
AsuHPI	GGTGA	1 cut(s)	82
AvaI	CYCGRG	1 cut(s)	56
BbsI	GAAGAC	1 cut(s)	186
BbvI	GCAGC	2 cut(s)	34, 65
BfaI	CTAG	1 cut(s)	32
BisI	GCNGC	2 cut(s)	48, 79
BlsI	GCNGC	2 cut(s)	49, 80
BmeT110I	CYCGRG	1 cut(s)	56
BmsI	GCATC	1 cut(s)	65
BpiI	GAAGAC	1 cut(s)	186
BpuEI	CTTGAG	1 cut(s)	176
BsaJI	CCNNGG	1 cut(s)	20
Bse118I	RCCGGY	1 cut(s)	92
BseDI	CCNNGG	1 cut(s)	20
BseGI	GGATG	1 cut(s)	109
BseX3I	CGGCCG	1 cut(s)	94
BseXI	GCAGC	2 cut(s)	34, 65
BsgI	GTGCAG	1 cut(s)	33
Bsh1285I	CGRYCG	1 cut(s)	97
BshFI	GGCC	2 cut(s)	39, 96
BsiEI	CGRYCG	1 cut(s)	97
BsiHKCI	CYCGRG	1 cut(s)	56
BsiSI	CCGG	1 cut(s)	93
BsnI	GGCC	2 cut(s)	39, 96
BsoBI	CYCGRG	1 cut(s)	56
BspANI	GGCC	2 cut(s)	39, 96
BsrFI	RCCGGY	1 cut(s)	92
BssAI	RCCGGY	1 cut(s)	92
BssECI	CCNNGG	1 cut(s)	20
Bst4CI	ACNGT	1 cut(s)	21
BstDSI	CCRYGG	1 cut(s)	20
BstF5I	GGATG	1 cut(s)	109
BstMCI	CGRYCG	1 cut(s)	97
BstV1I	GCAGC	2 cut(s)	34, 65
BstV2I	GAAGAC	1 cut(s)	186
BstZI	CGGCCG	1 cut(s)	94
BsuRI	GGCC	2 cut(s)	39, 96
BtgI	CCRYGG	1 cut(s)	20
BtsCI	GGATG	1 cut(s)	109
Cfr10I	RCCGGY	1 cut(s)	92
CviJI	RGCY	7 cut(s)	31, 39, 47, 55, 61, 96, 154
CviKI_1	RGCY	7 cut(s)	31, 39, 47, 55, 61, 96, 154
EaeI	YGGCCR	1 cut(s)	94
EagI	CGGCCG	1 cut(s)	94
EclXI	CGGCCG	1 cut(s)	94
Eco32I	GATATC	1 cut(s)	101
Eco52I	CGGCCG	1 cut(s)	94
Eco88I	CYCGRG	1 cut(s)	56
EcoRI	GAATTC	1 cut(s)	65
EcoRV	GATATC	1 cut(s)	101
FaiI	YATR	1 cut(s)	163
Fnu4HI	GCNGC	2 cut(s)	48, 79
FokI	GGATG	1 cut(s)	96
Fsp4HI	GCNGC	2 cut(s)	48, 79
FspBI	CTAG	1 cut(s)	32
GluI	GCNGC	2 cut(s)	48, 79
HaeIII	GGCC	2 cut(s)	39, 96
HapII	CCGG	1 cut(s)	93
HinfI	GANTC	2 cut(s)	121, 131
HpaII	CCGG	1 cut(s)	93
HphI	GGTGA	1 cut(s)	82
Hpy188I	TCNGA	1 cut(s)	114
HpyAV	CCTTC	2 cut(s)	19, 97
HpyCH4III	ACNGT	1 cut(s)	21
HpyCH4V	TGCA	1 cut(s)	50
LmnI	GCTCC	1 cut(s)	28
LpnPI	CCDG	3 cut(s)	47, 106, 135
Lsp1109I	GCAGC	2 cut(s)	34, 65
LweI	GCATC	1 cut(s)	65
MaeI	CTAG	1 cut(s)	32
MboII	GAAGA	1 cut(s)	191
MluCI	AATT	1 cut(s)	65
MmeI	TCCRAC	1 cut(s)	137
MnlI	CCTC	4 cut(s)	29, 127, 151, 181
MspI	CCGG	1 cut(s)	93
NmeAIII	GCCGAG	1 cut(s)	65
PaeR7I	CTCGAG	1 cut(s)	56
PfeI	GAWTC	2 cut(s)	121, 131
PkrI	GCNGC	2 cut(s)	49, 80
PspXI	VCTCGAGB	1 cut(s)	56
SatI	GCNGC	2 cut(s)	48, 79
SetI	ASST	7 cut(s)	33, 49, 57, 63, 119, 143, 162
SfaNI	GCATC	1 cut(s)	65
Sfr274I	CTCGAG	1 cut(s)	56
SlaI	CTCGAG	1 cut(s)	56
SmlI	CTYRAG	2 cut(s)	56, 155
SmoI	CTYRAG	2 cut(s)	56, 155
Sse9I	AATT	1 cut(s)	65
SspMI	CTAG	1 cut(s)	32
TaaI	ACNGT	1 cut(s)	21
TaqI	TCGA	4 cut(s)	57, 119, 124, 186
TasI	AATT	1 cut(s)	65
TfiI	GAWTC	2 cut(s)	121, 131
TseI	GCWGC	2 cut(s)	47, 78
TspDTI	ATGAA	1 cut(s)	17
XapI	RAATTY	1 cut(s)	65
XhoI	CTCGAG	1 cut(s)	56
XspI	CTAG	1 cut(s)	32

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.