Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0004553

Physical Location & Seq

Genomic Coordinates Reverse (-)

11620577 .. 11627506

Gene Structure 6930 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00089680.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 255 bp

ATGCTGCTCTTCCTTCACCGGCCGATATCTCTCTCATCTGACCTCGAATCGAAAGACATCAAAGTGAGAAAAGAACCGTGCAAGGCGCTAGGAGGCCGAGAAGCTGCACAGCTCGAGCTGGAATTCGCCCGATGCTGCTCTTCCTTCACCGGCCGATATCTCTCTCATCTGACCTCGAATCGAGTTGATTCCAAAAGGTATTTTTCTGGGCTTGAGCTATACTACAACTTTGTAGAAGACATCGAGGGGAAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

84

Amino Acids

9.66

Weight (kDa)

7.72

Isoelectric Point (pI)

27.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004553)

Species	Orthologous Gene IDs
pyrus_communis	pycom08g17200
rosa_chinensis	RchiOBHm_Chr2g0131311 RchiOBHm_Chr7g0219971
rosa_laevigata	RLG00000009451 RLG00000034059
rosa_multiflora	Rmu_sc0002758.1_g000005 Rmu_sc0003861.1_g000004 Rmu_sc0018646.1_g000002
rosa_roxburghii	Rroxscaffold_175G00432220 Rroxscaffold_1G00030210 Rroxscaffold_1G00033050 Rroxscaffold_1G00034250 Rroxscaffold_1G00039200 Rroxscaffold_2G00078570 Rroxscaffold_2G00089680 Rroxscaffold_2G00145370 Rroxscaffold_4G00308230 Rroxscaffold_4G00318460 Rroxscaffold_4G00321200 Rroxscaffold_4G00322640 Rroxscaffold_4G00325620 Rroxscaffold_4G00325790 Rroxscaffold_5G00344550 Rroxscaffold_5G00346240 Rroxscaffold_5G00356260 Rroxscaffold_5G00363420 Rroxscaffold_5G00376620 Rroxscaffold_7G00197800 Rroxscaffold_7G00198690 Rroxscaffold_7G00200910
rosa_samantha	Rh1CG272800 Rh5AG536300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	2 cut(s)	20, 151
AcsI	RAATTY	1 cut(s)	122
AluBI	AGCT	4 cut(s)	104, 112, 118, 217
AluI	AGCT	4 cut(s)	104, 112, 118, 217
Ama87I	CYCGRG	1 cut(s)	113
AoxI	GGCC	3 cut(s)	20, 94, 151
ApeKI	GCWGC	3 cut(s)	4, 104, 135
ApoI	RAATTY	1 cut(s)	122
AspLEI	GCGC	1 cut(s)	88
AsuHPI	GGTGA	2 cut(s)	8, 139
AvaI	CYCGRG	1 cut(s)	113
BbsI	GAAGAC	1 cut(s)	243
BbvI	GCAGC	2 cut(s)	91, 122
BfaI	CTAG	1 cut(s)	89
BfoI	RGCGCY	1 cut(s)	89
BisI	GCNGC	3 cut(s)	5, 105, 136
BlsI	GCNGC	3 cut(s)	6, 106, 137
BmeT110I	CYCGRG	1 cut(s)	113
BmsI	GCATC	1 cut(s)	122
BpiI	GAAGAC	1 cut(s)	243
BpuEI	CTTGAG	1 cut(s)	233
Bse118I	RCCGGY	2 cut(s)	18, 149
BseX3I	CGGCCG	2 cut(s)	20, 151
BseXI	GCAGC	2 cut(s)	91, 122
BsgI	GTGCAG	1 cut(s)	90
Bsh1285I	CGRYCG	2 cut(s)	23, 154
BshFI	GGCC	3 cut(s)	22, 96, 153
BsiEI	CGRYCG	2 cut(s)	23, 154
BsiHKCI	CYCGRG	1 cut(s)	113
BsiSI	CCGG	2 cut(s)	19, 150
BsnI	GGCC	3 cut(s)	22, 96, 153
BsoBI	CYCGRG	1 cut(s)	113
BspANI	GGCC	3 cut(s)	22, 96, 153
BspQI	GCTCTTC	2 cut(s)	14, 145
BsrFI	RCCGGY	2 cut(s)	18, 149
BssAI	RCCGGY	2 cut(s)	18, 149
Bst4CI	ACNGT	1 cut(s)	78
Bst6I	CTCTTC	2 cut(s)	14, 145
BstH2I	RGCGCY	1 cut(s)	89
BstHHI	GCGC	1 cut(s)	88
BstMCI	CGRYCG	2 cut(s)	23, 154
BstV1I	GCAGC	2 cut(s)	91, 122
BstV2I	GAAGAC	1 cut(s)	243
BstZI	CGGCCG	2 cut(s)	20, 151
BsuRI	GGCC	3 cut(s)	22, 96, 153
CfoI	GCGC	1 cut(s)	88
Cfr10I	RCCGGY	2 cut(s)	18, 149
CviJI	RGCY	8 cut(s)	22, 96, 104, 112, 118, 153, 211, 217
CviKI_1	RGCY	8 cut(s)	22, 96, 104, 112, 118, 153, 211, 217
EaeI	YGGCCR	2 cut(s)	20, 151
EagI	CGGCCG	2 cut(s)	20, 151
Eam1104I	CTCTTC	2 cut(s)	14, 145
EarI	CTCTTC	2 cut(s)	14, 145
EclXI	CGGCCG	2 cut(s)	20, 151
Eco32I	GATATC	2 cut(s)	27, 158
Eco52I	CGGCCG	2 cut(s)	20, 151
Eco88I	CYCGRG	1 cut(s)	113
EcoRI	GAATTC	1 cut(s)	122
EcoRV	GATATC	2 cut(s)	27, 158
FaiI	YATR	1 cut(s)	220
Fnu4HI	GCNGC	3 cut(s)	5, 105, 136
Fsp4HI	GCNGC	3 cut(s)	5, 105, 136
FspBI	CTAG	1 cut(s)	89
GlaI	GCGC	1 cut(s)	87
GluI	GCNGC	3 cut(s)	5, 105, 136
HaeII	RGCGCY	1 cut(s)	89
HaeIII	GGCC	3 cut(s)	22, 96, 153
HapII	CCGG	2 cut(s)	19, 150
HhaI	GCGC	1 cut(s)	88
Hin6I	GCGC	1 cut(s)	86
HinP1I	GCGC	1 cut(s)	86
HinfI	GANTC	3 cut(s)	47, 178, 188
HpaII	CCGG	2 cut(s)	19, 150
HphI	GGTGA	2 cut(s)	8, 139
Hpy188I	TCNGA	2 cut(s)	40, 171
HpyAV	CCTTC	2 cut(s)	23, 154
HpyCH4III	ACNGT	1 cut(s)	78
HpyCH4V	TGCA	2 cut(s)	81, 107
HspAI	GCGC	1 cut(s)	86
LguI	GCTCTTC	2 cut(s)	14, 145
LpnPI	CCDG	4 cut(s)	32, 104, 163, 192
Lsp1109I	GCAGC	2 cut(s)	91, 122
LweI	GCATC	1 cut(s)	122
MaeI	CTAG	1 cut(s)	89
MboII	GAAGA	2 cut(s)	132, 248
MluCI	AATT	1 cut(s)	122
MnlI	CCTC	4 cut(s)	53, 86, 184, 238
MslI	CAYNNNNRTG	1 cut(s)	62
MspI	CCGG	2 cut(s)	19, 150
NmeAIII	GCCGAG	1 cut(s)	122
PaeR7I	CTCGAG	1 cut(s)	113
PciSI	GCTCTTC	2 cut(s)	14, 145
PfeI	GAWTC	3 cut(s)	47, 178, 188
PkrI	GCNGC	3 cut(s)	6, 106, 137
PspXI	VCTCGAGB	1 cut(s)	113
RseI	CAYNNNNRTG	1 cut(s)	62
SapI	GCTCTTC	2 cut(s)	14, 145
SatI	GCNGC	3 cut(s)	5, 105, 136
SetI	ASST	7 cut(s)	45, 106, 114, 120, 176, 200, 219
SfaNI	GCATC	1 cut(s)	122
Sfr274I	CTCGAG	1 cut(s)	113
SlaI	CTCGAG	1 cut(s)	113
SmiMI	CAYNNNNRTG	1 cut(s)	62
SmlI	CTYRAG	2 cut(s)	113, 212
SmoI	CTYRAG	2 cut(s)	113, 212
Sse9I	AATT	1 cut(s)	122
SspMI	CTAG	1 cut(s)	89
TaaI	ACNGT	1 cut(s)	78
TaqI	TCGA	6 cut(s)	45, 50, 114, 176, 181, 243
TasI	AATT	1 cut(s)	122
TfiI	GAWTC	3 cut(s)	47, 178, 188
TseI	GCWGC	3 cut(s)	4, 104, 135
XapI	RAATTY	1 cut(s)	122
XhoI	CTCGAG	1 cut(s)	113
XspI	CTAG	1 cut(s)	89

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.