Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004781.1

Orthogroup ID

OG0001930

Physical Location & Seq

Genomic Coordinates Reverse (-)

24419 .. 28779

Gene Structure 4361 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004781.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1197 bp

atggagaccggtcgtcgtcttcacccagccgggttccacaacgtcaactcgcgcctcgagaccttgcacgagctcaagagcctcctcgctggccctccacaccgatttgatcttgcaagtttgggaactggtgacaggggtcaaaatcttcttgaagctatcctagatttaaaatttgaaaacctcagtgggaatttccggttggttaaggggcagttggaagcttcaacctttgaggtatttaatgtgattggcggaaaagaaagaataattggatattggaaccaaaagaaaggactttcccgaaagctgaatggagcagcagagttggataaaaggaggacactcgagaaaccaatctggccagggtatactacagacatccctccgaaattgaggattggagttcccatgaaacagggagtttccatgatagttttgacagaagacagtgagatgaatagtctttggattttcttgaagccactaagcttggatctttggttgacaaccggcgcagccttcatatttacaggttttgtaatatggcttcttgagcaccgggaaaacaccgagttcagaggtcatccacagcaacaattcggaatgatattctggttctccttttcgaccctcgtctttgcacacaaccaccacgtgtactccctacccggccctagcgaatcgggctttttcgagcgggccttcccaatagggtccccgctggtatcctacatgtcgagggcaatcttgaacgtgactcaagataaaaatcagatggatagcattcagtcgacttactttgattacaaacctgcctgtgaggatcaaggtgccaaaatttcttcagagggtccaagtcttcgtgtctacagcttcggaggcctcttcatcatttcaagtgtggtctccatggctgctcttttgatgtacatgtatcacttcctttgctctcattggccagctttgcgaaccattagttcttctgagagcacattttgggagaaattggttgaagtggcaaagcattttgacaagaaagatctcactccacatcagtttaagcgaagagaatcaagagtacatgctttagacactcctgatgaaggtctagcagctgcaccgggtgctaatgatatgcaaaacaactcagcaggaactcacataacagtggagaacaatcttggacatgaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ANF_receptor Lig_chan SBP_bac_3

Protein Analysis

398

Amino Acids

44.88

Weight (kDa)

6.77

Isoelectric Point (pI)

38.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001930)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g06680 FvH4_3g38721 FvH4_4g08410 FvH4_6g06360
prunus_persica	Prupe.1G094600_v2.0.a1 Prupe.1G094700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0403951 RchiOBHm_Chr4g0403991 RchiOBHm_Chr4g0404001 RchiOBHm_Chr4g0404021 RchiOBHm_Chr4g0404081
rosa_laevigata	RLG00000008927 RLG00000008928 RLG00000008929 RLG00000008931 RLG00000008934 RLG00000008935 RLG00000008938 RLG00000008939 RLG00000019466 RLG00000027985 RLG00000032399
rosa_multiflora	Rmu_co8070616.1_g000001 Rmu_co8395539.1_g000001 Rmu_sc0003478.1_g000001 Rmu_sc0003483.1_g000003 Rmu_sc0004781.1_g000004 Rmu_sc0005134.1_g000003 Rmu_sc0006579.1_g000019 Rmu_sc0026037.1_g000003
rosa_roxburghii	Rroxscaffold_5G00348550 Rroxscaffold_5G00348600
rosa_rugosa	Rorug04G0046400 Rorug04G0046700 Rorug04G0046700
rosa_samantha	Rh4BG115300 Rh4BG115500 Rh4CG130700 Rh4CG130800 Rh4DG115400 Rh4DG115700
rosa_wichuraiana	Rw4G009780 Rw4G009790 Rw4G009800 Rw4G009930 Rw4G009940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	823
AccB1I	GGYRCC	1 cut(s)	833
AccBSI	CCGCTC	1 cut(s)	700
AccI	GTMKAC	3 cut(s)	371, 794, 870
AccII	CGCG	1 cut(s)	52
AciI	CCGC	3 cut(s)	255, 700, 722
AclWI	GGATC	2 cut(s)	504, 834
AcoI	YGGCCR	2 cut(s)	362, 959
AcsI	RAATTY	3 cut(s)	173, 193, 840
AcuI	CTGAAG	1 cut(s)	831
AcvI	CACGTG	1 cut(s)	658
AdeI	CACNNNGTG	2 cut(s)	658, 1127
AfaI	GTAC	3 cut(s)	662, 932, 1083
AfiI	CCNNNNNNNGG	1 cut(s)	1106
AflIII	ACRYGT	3 cut(s)	657, 735, 933
AgeI	ACCGGT	1 cut(s)	8
AgsI	TTSAA	7 cut(s)	155, 179, 228, 481, 754, 900, 1016
AhdI	GACNNNNNGTC	1 cut(s)	12
AjnI	CCWGG	1 cut(s)	364
AjuI	GAANNNNNNNTTGG	4 cut(s)	185, 217, 255, 287
AluBI	AGCT	8 cut(s)	73, 158, 224, 310, 492, 876, 965, 1118
AluI	AGCT	8 cut(s)	73, 158, 224, 310, 492, 876, 965, 1118
Alw21I	GWGCWC	3 cut(s)	75, 561, 995
Alw26I	GTCTC	2 cut(s)	53, 913
AlwI	GGATC	2 cut(s)	504, 834
Ama87I	CYCGRG	2 cut(s)	56, 347
AoxI	GGCC	6 cut(s)	91, 362, 673, 702, 883, 959
ApeKI	GCWGC	5 cut(s)	320, 518, 917, 1115, 1118
ApoI	RAATTY	3 cut(s)	173, 193, 840
AsiGI	ACCGGT	1 cut(s)	8
AspLEI	GCGC	2 cut(s)	54, 518
AspS9I	GGNCC	5 cut(s)	92, 674, 702, 717, 854
AsuC2I	CCSGG	4 cut(s)	31, 563, 672, 1125
AsuHPI	GGTGA	2 cut(s)	14, 143
AvaI	CYCGRG	2 cut(s)	56, 347
AvaII	GGWCC	2 cut(s)	717, 854
BalI	TGGCCA	2 cut(s)	364, 961
BanI	GGYRCC	1 cut(s)	833
BanII	GRGCYC	1 cut(s)	75
BarI	GAAGNNNNNNTAC	2 cut(s)	534, 566
BauI	CACGAG	1 cut(s)	68
BbrPI	CACGTG	1 cut(s)	658
BbsI	GAAGAC	3 cut(s)	11, 453, 854
Bbv12I	GWGCWC	3 cut(s)	75, 561, 995
BbvI	GCAGC	5 cut(s)	332, 530, 904, 1105, 1127
BccI	CCATC	1 cut(s)	772
BciT130I	CCWGG	1 cut(s)	366
BciVI	GTATCC	1 cut(s)	739
BcnI	CCSGG	4 cut(s)	31, 563, 672, 1125
BcoDI	GTCTC	2 cut(s)	53, 913
BfaI	CTAG	3 cut(s)	164, 678, 1112
BfmI	CTRYAG	2 cut(s)	375, 871
BfuAI	ACCTGC	1 cut(s)	823
BfuI	GTATCC	1 cut(s)	739
BglII	AGATCT	1 cut(s)	1042
BisI	GCNGC	5 cut(s)	321, 519, 918, 1116, 1119
BlsI	GCNGC	5 cut(s)	322, 520, 919, 1117, 1120
Bme1390I	CCNGG	5 cut(s)	31, 366, 563, 672, 1125
Bme18I	GGWCC	2 cut(s)	717, 854
BmeRI	GACNNNNNGTC	1 cut(s)	12
BmeT110I	CYCGRG	2 cut(s)	56, 347
BmgT120I	GGNCC	5 cut(s)	92, 674, 702, 717, 854
BmiI	GGNNCC	6 cut(s)	35, 284, 718, 719, 835, 855
BmrFI	CCNGG	5 cut(s)	31, 366, 563, 672, 1125
BoxI	GACNNNNGTC	2 cut(s)	138, 635
BpiI	GAAGAC	3 cut(s)	11, 453, 854
BpuEI	CTTGAG	3 cut(s)	59, 575, 747
BpuMI	CCSGG	4 cut(s)	31, 563, 672, 1125
BsaAI	YACGTR	1 cut(s)	658
BsaBI	GATNNNNATC	1 cut(s)	771
BsaI	GGTCTC	2 cut(s)	53, 913
BsaJI	CCNNGG	2 cut(s)	365, 912
BsaWI	WCCGGW	2 cut(s)	8, 198
BsaXI	ACNNNNNCTCC	2 cut(s)	647, 677
Bsc4I	CCNNNNNNNGG	1 cut(s)	1106
Bse118I	RCCGGY	2 cut(s)	8, 512
Bse1I	ACTGG	1 cut(s)	133
Bse8I	GATNNNNATC	1 cut(s)	771
BseBI	CCWGG	1 cut(s)	366
BseDI	CCNNGG	2 cut(s)	365, 912
BseGI	GGATG	2 cut(s)	381, 586
BseJI	GATNNNNATC	1 cut(s)	771
BseLI	CCNNNNNNNGG	1 cut(s)	1106
BseMII	CTCAG	3 cut(s)	199, 978, 1164
BseNI	ACTGG	1 cut(s)	133
BseRI	GAGGAG	1 cut(s)	74
BseXI	GCAGC	5 cut(s)	332, 530, 904, 1105, 1127
BseYI	CCCAGC	1 cut(s)	25
BsgI	GTGCAG	1 cut(s)	1104
Bsh1236I	CGCG	1 cut(s)	52
Bsh1285I	CGRYCG	1 cut(s)	13
BshFI	GGCC	6 cut(s)	93, 364, 675, 704, 885, 961
BshNI	GGYRCC	1 cut(s)	833
BshTI	ACCGGT	1 cut(s)	8
BsiEI	CGRYCG	1 cut(s)	13
BsiHKAI	GWGCWC	3 cut(s)	75, 561, 995
BsiHKCI	CYCGRG	2 cut(s)	56, 347
BsiSI	CCGG	7 cut(s)	9, 30, 199, 513, 562, 672, 1124
BslFI	GGGAC	1 cut(s)	703
BslI	CCNNNNNNNGG	1 cut(s)	1106
BsmAI	GTCTC	2 cut(s)	53, 913
BsmFI	GGGAC	1 cut(s)	703
BsmI	GAATGC	1 cut(s)	786
BsnI	GGCC	6 cut(s)	93, 364, 675, 704, 885, 961
Bso31I	GGTCTC	2 cut(s)	53, 913
BsoBI	CYCGRG	2 cut(s)	56, 347
Bsp1286I	GDGCHC	3 cut(s)	75, 561, 995
Bsp1407I	TGTACA	1 cut(s)	930
Bsp143I	GATC	4 cut(s)	109, 496, 826, 1042
Bsp19I	CCATGG	1 cut(s)	912
BspACI	CCGC	3 cut(s)	255, 700, 722
BspANI	GGCC	6 cut(s)	93, 364, 675, 704, 885, 961
BspCNI	CTCAG	3 cut(s)	198, 979, 1163
BspFNI	CGCG	1 cut(s)	52
BspLI	GGNNCC	6 cut(s)	35, 284, 718, 719, 835, 855
BspMI	ACCTGC	1 cut(s)	823
BspPI	GGATC	2 cut(s)	504, 834
BspT107I	GGYRCC	1 cut(s)	833
BspTNI	GGTCTC	2 cut(s)	53, 913
BsrBI	CCGCTC	1 cut(s)	700
BsrFI	RCCGGY	2 cut(s)	8, 512
BsrGI	TGTACA	1 cut(s)	930
BsrI	ACTGG	1 cut(s)	133
BssAI	RCCGGY	2 cut(s)	8, 512
BssECI	CCNNGG	2 cut(s)	365, 912
BssMI	GATC	4 cut(s)	109, 496, 826, 1042
BssNAI	GTATAC	1 cut(s)	372
BssSI	CACGAG	1 cut(s)	68
BssT1I	CCWWGG	1 cut(s)	912
Bst1107I	GTATAC	1 cut(s)	372
Bst2BI	CACGAG	1 cut(s)	68
Bst2UI	CCWGG	1 cut(s)	366
Bst4CI	ACNGT	2 cut(s)	452, 1171
Bst6I	CTCTTC	2 cut(s)	893, 1063
BstAPI	GCANNNNNTGC	1 cut(s)	1127
BstAUI	TGTACA	1 cut(s)	930
BstBAI	YACGTR	1 cut(s)	658
BstC8I	GCNNGC	3 cut(s)	91, 702, 963
BstDEI	CTNAG	4 cut(s)	185, 488, 987, 1150
BstDSI	CCRYGG	1 cut(s)	912
BstENI	CCTNNNNNAGG	1 cut(s)	1104
BstF5I	GGATG	2 cut(s)	381, 586
BstFNI	CGCG	1 cut(s)	52
BstHHI	GCGC	2 cut(s)	54, 518
BstKTI	GATC	4 cut(s)	112, 499, 829, 1045
BstMAI	GTCTC	2 cut(s)	53, 913
BstMBI	GATC	4 cut(s)	109, 496, 826, 1042
BstMCI	CGRYCG	1 cut(s)	13
BstMWI	GCNNNNNNNGC	5 cut(s)	556, 687, 882, 967, 1127
BstNI	CCWGG	1 cut(s)	366
BstNSI	RCATGY	3 cut(s)	739, 937, 1088
BstPAI	GACNNNNGTC	2 cut(s)	138, 635
BstSCI	CCNGG	5 cut(s)	29, 364, 561, 670, 1123
BstSFI	CTRYAG	2 cut(s)	375, 871
BstUI	CGCG	1 cut(s)	52
BstV1I	GCAGC	5 cut(s)	332, 530, 904, 1105, 1127
BstV2I	GAAGAC	3 cut(s)	11, 453, 854
BstX2I	RGATCY	2 cut(s)	496, 1042
BstYI	RGATCY	2 cut(s)	496, 1042
BstZ17I	GTATAC	1 cut(s)	372
BsuI	GTATCC	1 cut(s)	739
BsuRI	GGCC	6 cut(s)	93, 364, 675, 704, 885, 961
BtgI	CCRYGG	1 cut(s)	912
BtsCI	GGATG	2 cut(s)	381, 586
BtsIMutI	CAGTG	3 cut(s)	193, 457, 1176
BveI	ACCTGC	1 cut(s)	823
Cac8I	GCNNGC	3 cut(s)	91, 702, 963
CfoI	GCGC	2 cut(s)	54, 518
Cfr10I	RCCGGY	2 cut(s)	8, 512
Cfr13I	GGNCC	5 cut(s)	92, 674, 702, 717, 854
Csp6I	GTAC	3 cut(s)	661, 931, 1082
CspAI	ACCGGT	1 cut(s)	8
CspCI	CAANNNNNGTGG	2 cut(s)	474, 509
CviAII	CATG	7 cut(s)	412, 430, 736, 913, 934, 1085, 1190
CviQI	GTAC	3 cut(s)	661, 931, 1082
DdeI	CTNAG	4 cut(s)	185, 488, 987, 1150
DpnI	GATC	4 cut(s)	111, 498, 828, 1044
DpnII	GATC	4 cut(s)	109, 496, 826, 1042
DraI	TTTAAA	1 cut(s)	171
DraIII	CACNNNGTG	2 cut(s)	658, 1127
DriI	GACNNNNNGTC	1 cut(s)	12
EaeI	YGGCCR	2 cut(s)	362, 959
Eam1104I	CTCTTC	2 cut(s)	893, 1063
Eam1105I	GACNNNNNGTC	1 cut(s)	12
EarI	CTCTTC	2 cut(s)	893, 1063
EciI	GGCGGA	1 cut(s)	270
Ecl136II	GAGCTC	1 cut(s)	73
Eco130I	CCWWGG	1 cut(s)	912
Eco147I	AGGCCT	1 cut(s)	885
Eco24I	GRGCYC	1 cut(s)	75
Eco31I	GGTCTC	2 cut(s)	53, 913
Eco47I	GGWCC	2 cut(s)	717, 854
Eco53kI	GAGCTC	1 cut(s)	73
Eco57I	CTGAAG	1 cut(s)	831
Eco72I	CACGTG	1 cut(s)	658
Eco88I	CYCGRG	2 cut(s)	56, 347
EcoICRI	GAGCTC	1 cut(s)	73
EcoNI	CCTNNNNNAGG	1 cut(s)	1104
EcoO109I	RGGNCCY	1 cut(s)	717
EcoRII	CCWGG	1 cut(s)	364
EcoT14I	CCWWGG	1 cut(s)	912
EcoT38I	GRGCYC	1 cut(s)	75
ErhI	CCWWGG	1 cut(s)	912
FaeI	CATG	7 cut(s)	415, 433, 739, 916, 937, 1088, 1193
FaqI	GGGAC	1 cut(s)	703
FatI	CATG	7 cut(s)	411, 429, 735, 912, 933, 1084, 1189
FauI	CCCGC	2 cut(s)	693, 729
FblI	GTMKAC	3 cut(s)	371, 794, 870
Fnu4HI	GCNGC	5 cut(s)	321, 519, 918, 1116, 1119
FokI	GGATG	2 cut(s)	368, 573
FriOI	GRGCYC	1 cut(s)	75
Fsp4HI	GCNGC	5 cut(s)	321, 519, 918, 1116, 1119
FspBI	CTAG	3 cut(s)	164, 678, 1112
GlaI	GCGC	2 cut(s)	53, 517
GluI	GCNGC	5 cut(s)	321, 519, 918, 1116, 1119
GsaI	CCCAGC	1 cut(s)	29
HaeIII	GGCC	6 cut(s)	93, 364, 675, 704, 885, 961
HapII	CCGG	7 cut(s)	9, 30, 199, 513, 562, 672, 1124
HhaI	GCGC	2 cut(s)	54, 518
Hin1II	CATG	7 cut(s)	415, 433, 739, 916, 937, 1088, 1193
Hin6I	GCGC	2 cut(s)	52, 516
HinP1I	GCGC	2 cut(s)	52, 516
HincII	GTYRAC	3 cut(s)	46, 507, 795
HindII	GTYRAC	3 cut(s)	46, 507, 795
HindIII	AAGCTT	2 cut(s)	222, 490
HinfI	GANTC	3 cut(s)	683, 760, 1073
HpaII	CCGG	7 cut(s)	9, 30, 199, 513, 562, 672, 1124
HphI	GGTGA	2 cut(s)	14, 143
Hpy166II	GTNNAC	6 cut(s)	46, 372, 507, 661, 795, 871
Hpy188I	TCNGA	7 cut(s)	390, 581, 605, 777, 850, 881, 988
Hpy8I	GTNNAC	6 cut(s)	46, 372, 507, 661, 795, 871
Hpy99I	CGWCG	1 cut(s)	18
HpyAV	CCTTC	3 cut(s)	532, 715, 1100
HpyCH4III	ACNGT	2 cut(s)	452, 1171
HpyCH4IV	ACGT	3 cut(s)	42, 657, 756
HpyCH4V	TGCA	5 cut(s)	67, 116, 644, 1121, 1141
HpyF10VI	GCNNNNNNNGC	5 cut(s)	556, 687, 882, 967, 1127
HpyF3I	CTNAG	4 cut(s)	185, 488, 987, 1150
HpySE526I	ACGT	3 cut(s)	42, 657, 756
Hsp92II	CATG	7 cut(s)	415, 433, 739, 916, 937, 1088, 1193
HspAI	GCGC	2 cut(s)	52, 516
KflI	GGGWCCC	1 cut(s)	717
Kzo9I	GATC	4 cut(s)	109, 496, 826, 1042
LmnI	GCTCC	1 cut(s)	317
Lsp1109I	GCAGC	5 cut(s)	332, 530, 904, 1105, 1127
MaeI	CTAG	3 cut(s)	164, 678, 1112
MaeII	ACGT	3 cut(s)	42, 657, 756
MaeIII	GTNAC	2 cut(s)	131, 757
MalI	GATC	4 cut(s)	111, 498, 828, 1044
MbiI	CCGCTC	1 cut(s)	700
MboI	GATC	4 cut(s)	109, 496, 826, 1042
MboII	GAAGA	8 cut(s)	11, 140, 458, 837, 854, 880, 975, 1080
MflI	RGATCY	2 cut(s)	496, 1042
MhlI	GDGCHC	3 cut(s)	75, 561, 995
MlsI	TGGCCA	2 cut(s)	364, 961
MluCI	AATT	7 cut(s)	173, 193, 270, 392, 599, 840, 1007
MluNI	TGGCCA	2 cut(s)	364, 961
MlyI	GAGTC	1 cut(s)	754
MmeI	TCCRAC	2 cut(s)	198, 309
Mox20I	TGGCCA	2 cut(s)	364, 961
MscI	TGGCCA	2 cut(s)	364, 961
MseI	TTAA	4 cut(s)	170, 207, 243, 1062
MslI	CAYNNNNRTG	1 cut(s)	1169
Msp20I	TGGCCA	2 cut(s)	364, 961
MspA1I	CMGCKG	2 cut(s)	724, 1118
MspI	CCGG	7 cut(s)	9, 30, 199, 513, 562, 672, 1124
MspR9I	CCNGG	5 cut(s)	31, 366, 563, 672, 1125
Mva1269I	GAATGC	1 cut(s)	786
MvaI	CCWGG	1 cut(s)	366
MvnI	CGCG	1 cut(s)	52
MwoI	GCNNNNNNNGC	5 cut(s)	556, 687, 882, 967, 1127
NciI	CCSGG	4 cut(s)	31, 563, 672, 1125
NcoI	CCATGG	1 cut(s)	912
NdeII	GATC	4 cut(s)	109, 496, 826, 1042
NlaIII	CATG	7 cut(s)	415, 433, 739, 916, 937, 1088, 1193
NlaIV	GGNNCC	6 cut(s)	35, 284, 718, 719, 835, 855
NmuCI	GTSAC	2 cut(s)	131, 757
NspI	RCATGY	3 cut(s)	739, 937, 1088
PaeR7I	CTCGAG	2 cut(s)	56, 347
PceI	AGGCCT	1 cut(s)	885
PciI	ACATGT	2 cut(s)	735, 933
PctI	GAATGC	1 cut(s)	786
PfeI	GAWTC	2 cut(s)	683, 1073
PinAI	ACCGGT	1 cut(s)	8
PkrI	GCNGC	5 cut(s)	322, 520, 919, 1117, 1120
PleI	GAGTC	1 cut(s)	754
PmaCI	CACGTG	1 cut(s)	658
PmlI	CACGTG	1 cut(s)	658
PpsI	GAGTC	1 cut(s)	754
Ppu21I	YACGTR	1 cut(s)	658
PpuMI	RGGWCCY	1 cut(s)	717
PscI	ACATGT	2 cut(s)	735, 933
PshAI	GACNNNNGTC	2 cut(s)	138, 635
Psp124BI	GAGCTC	1 cut(s)	75
Psp5II	RGGWCCY	1 cut(s)	717
Psp6I	CCWGG	1 cut(s)	364
PspCI	CACGTG	1 cut(s)	658
PspFI	CCCAGC	1 cut(s)	25
PspGI	CCWGG	1 cut(s)	364
PspN4I	GGNNCC	6 cut(s)	35, 284, 718, 719, 835, 855
PspPI	GGNCC	5 cut(s)	92, 674, 702, 717, 854
PspPPI	RGGWCCY	1 cut(s)	717
PsuI	RGATCY	2 cut(s)	496, 1042
PvuII	CAGCTG	1 cut(s)	1118
RsaI	GTAC	3 cut(s)	662, 932, 1083
RsaNI	GTAC	3 cut(s)	661, 931, 1082
RseI	CAYNNNNRTG	1 cut(s)	1169
SacI	GAGCTC	1 cut(s)	75
SalI	GTCGAC	1 cut(s)	793
SaqAI	TTAA	4 cut(s)	170, 207, 243, 1062
SatI	GCNGC	5 cut(s)	321, 519, 918, 1116, 1119
Sau3AI	GATC	4 cut(s)	109, 496, 826, 1042
Sau96I	GGNCC	5 cut(s)	92, 674, 702, 717, 854
SchI	GAGTC	1 cut(s)	754
ScrFI	CCNGG	5 cut(s)	31, 366, 563, 672, 1125
SduI	GDGCHC	3 cut(s)	75, 561, 995
SfcI	CTRYAG	2 cut(s)	375, 871
Sfr274I	CTCGAG	2 cut(s)	56, 347
SinI	GGWCC	2 cut(s)	717, 854
SlaI	CTCGAG	2 cut(s)	56, 347
SmiMI	CAYNNNNRTG	1 cut(s)	1169
SmlI	CTYRAG	5 cut(s)	56, 74, 347, 554, 762
SmoI	CTYRAG	5 cut(s)	56, 74, 347, 554, 762
Sse9I	AATT	7 cut(s)	173, 193, 270, 392, 599, 840, 1007
SseBI	AGGCCT	1 cut(s)	885
SsiI	CCGC	3 cut(s)	255, 700, 722
SspMI	CTAG	3 cut(s)	164, 678, 1112
SstI	GAGCTC	1 cut(s)	75
StuI	AGGCCT	1 cut(s)	885
StyD4I	CCNGG	5 cut(s)	29, 364, 561, 670, 1123
StyI	CCWWGG	1 cut(s)	912
TaaI	ACNGT	2 cut(s)	452, 1171
TaiI	ACGT	3 cut(s)	45, 660, 759
TaqI	TCGA	6 cut(s)	57, 348, 629, 696, 740, 794
TasI	AATT	7 cut(s)	173, 193, 270, 392, 599, 840, 1007
TatI	WGTACW	3 cut(s)	660, 930, 1081
TfiI	GAWTC	2 cut(s)	683, 1073
Tru1I	TTAA	4 cut(s)	170, 207, 243, 1062
Tru9I	TTAA	4 cut(s)	170, 207, 243, 1062
TscAI	CASTG	3 cut(s)	193, 457, 1176
TseFI	GTSAC	2 cut(s)	131, 757
TseI	GCWGC	5 cut(s)	320, 518, 917, 1115, 1118
Tsp45I	GTSAC	2 cut(s)	131, 757
TspDTI	ATGAA	5 cut(s)	428, 473, 514, 880, 1119
TspRI	CASTG	3 cut(s)	193, 457, 1176
VpaK11BI	GGWCC	2 cut(s)	717, 854
XagI	CCTNNNNNAGG	1 cut(s)	1104
XapI	RAATTY	3 cut(s)	173, 193, 840
XceI	RCATGY	3 cut(s)	739, 937, 1088
XhoI	CTCGAG	2 cut(s)	56, 347
XmiI	GTMKAC	3 cut(s)	371, 794, 870
XspI	CTAG	3 cut(s)	164, 678, 1112

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.