Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006727.1

Orthogroup ID

OG0002062

Physical Location & Seq

Genomic Coordinates Reverse (-)

4386 .. 4964

Gene Structure 579 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 579 bp

atggcgaatggaggaaaagatcattctgtcattatgatcgaagcagggaaaacagagtggcaacttcacccatcagctggaaacgaggcttgttgcatcttcagagttccccaatgccttacaaaaatacaccccaagacctaccagcctcacgtagtctccatcggcccttaccactatggaaaaccacatctgcagatgatgcaggagcacaaacagagatatcttggcgatctgcttgctcgaacaacatcaattggcccgaaacttgatgagtacctgcaggctgttgaatcaagggaaaatgatataagagattgctattcgaagaacatcaagtttggcagcggcgatctagttgagataatggtgctagacggtctcttcattatcgaactcttctgcaaagaattcaaaggactagtatcacaaccacagagtcatggtgacgatccgatttttaacttggcatgggtgaagcctaatctcatacgagatctcctcctgttggagaaccaaattcctttctttgttcttcaaatcttgtttgacaaaatcaaaagctttgagaaacgatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF247

Protein Analysis

192

Amino Acids

22.01

Weight (kDa)

6.7

Isoelectric Point (pI)

39.06

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DUF247	PF03140	33 - 186	1.9e-51	Plant protein of unknown function

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002062)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G44695 AT3G44700 AT3G44700 AT3G44710 AT5G22540 AT5G22550 AT5G22550 AT5G22560
fragaria_vesca	FvH4_1g12920 FvH4_1g13901 FvH4_1g13920
malus_domestica	MD02G1152400.v1.1 MD07G1114700.v1.1 MD07G1115000.v1.1 MD10G1144400.v1.1 MD10G1146500.v1.1
prunus_persica	Prupe.7G149800_v2.0.a1 Prupe.7G150000_v2.0.a1 Prupe.7G150500_v2.0.a1
pyrus_communis	pycom07g10000 pycom10g12420
rosa_chinensis	RchiOBHm_Chr2g0103321 RchiOBHm_Chr7g0226251
rosa_laevigata	RLG00000017223
rosa_multiflora	Rmu_sc0002435.1_g000011 Rmu_sc0006727.1_g000002 Rmu_sc0006743.1_g000002 Rmu_sc0006743.1_g000003 Rmu_sc0010053.1_g000005 Rmu_sc0025224.1_g000002
rosa_roxburghii	Rroxscaffold_2G00139740
rosa_rugosa	Rorug02G0105700 Rorug02G0105800 Rorug02G0105800 Rorug02G0113600 Rorug02G0113800 Rorug07G0236000
rosa_samantha	Rh2BG169200 Rh2CG169100 Rh2DG168000 Rh3BG095300
rosa_wichuraiana	Rw0G019400 Rw2G012010 Rw2G012730

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	288
AccB7I	CCANNNNNTGG	1 cut(s)	77
AciI	CCGC	1 cut(s)	348
AclWI	GGATC	1 cut(s)	446
AcsI	RAATTY	2 cut(s)	410, 519
AcuI	CTGAAG	1 cut(s)	85
AfaI	GTAC	1 cut(s)	278
AfiI	CCNNNNNNNGG	2 cut(s)	77, 508
AgsI	TTSAA	3 cut(s)	293, 415, 539
AhlI	ACTAGT	1 cut(s)	421
AluBI	AGCT	2 cut(s)	77, 564
AluI	AGCT	2 cut(s)	77, 564
Alw21I	GWGCWC	1 cut(s)	213
Alw26I	GTCTC	2 cut(s)	163, 386
AlwI	GGATC	1 cut(s)	446
AoxI	GGCC	2 cut(s)	166, 259
ApeKI	GCWGC	1 cut(s)	345
ApoI	RAATTY	2 cut(s)	410, 519
AspS9I	GGNCC	2 cut(s)	167, 260
AsuHPI	GGTGA	3 cut(s)	59, 458, 487
AsuII	TTCGAA	1 cut(s)	326
Bbv12I	GWGCWC	1 cut(s)	213
BbvI	GCAGC	1 cut(s)	357
BccI	CCATC	2 cut(s)	79, 170
BcgI	CGANNNNNNTGC	2 cut(s)	221, 255
BcoDI	GTCTC	2 cut(s)	163, 386
BcuI	ACTAGT	1 cut(s)	421
BfaI	CTAG	3 cut(s)	356, 374, 422
BfmI	CTRYAG	2 cut(s)	194, 281
BfuAI	ACCTGC	1 cut(s)	288
BglII	AGATCT	1 cut(s)	496
BisI	GCNGC	2 cut(s)	346, 349
BlsI	GCNGC	2 cut(s)	347, 350
BmgT120I	GGNCC	2 cut(s)	167, 260
BmsI	GCATC	2 cut(s)	105, 192
BplI	GAGNNNNNCTC	2 cut(s)	486, 518
Bpu14I	TTCGAA	1 cut(s)	326
BsaAI	YACGTR	1 cut(s)	154
BsaI	GGTCTC	1 cut(s)	386
BsaXI	ACNNNNNCTCC	4 cut(s)	143, 173, 483, 513
Bsc4I	CCNNNNNNNGG	2 cut(s)	77, 508
BseLI	CCNNNNNNNGG	2 cut(s)	77, 508
BseRI	GAGGAG	1 cut(s)	491
BseXI	GCAGC	1 cut(s)	357
BshFI	GGCC	2 cut(s)	168, 261
BsiHKAI	GWGCWC	1 cut(s)	213
BslI	CCNNNNNNNGG	2 cut(s)	77, 508
BsmAI	GTCTC	2 cut(s)	163, 386
BsnI	GGCC	2 cut(s)	168, 261
Bso31I	GGTCTC	1 cut(s)	386
Bsp119I	TTCGAA	1 cut(s)	326
Bsp1286I	GDGCHC	1 cut(s)	213
Bsp143I	GATC	6 cut(s)	19, 36, 232, 352, 451, 496
BspACI	CCGC	1 cut(s)	348
BspANI	GGCC	2 cut(s)	168, 261
BspMAI	CTGCAG	2 cut(s)	198, 285
BspMI	ACCTGC	1 cut(s)	288
BspPI	GGATC	1 cut(s)	446
BspT104I	TTCGAA	1 cut(s)	326
BspTNI	GGTCTC	1 cut(s)	386
BssMI	GATC	6 cut(s)	19, 36, 232, 352, 451, 496
Bst4CI	ACNGT	1 cut(s)	380
Bst6I	CTCTTC	2 cut(s)	389, 404
BstAPI	GCANNNNNTGC	1 cut(s)	202
BstBAI	YACGTR	1 cut(s)	154
BstBI	TTCGAA	1 cut(s)	326
BstC8I	GCNNGC	2 cut(s)	240, 285
BstKTI	GATC	6 cut(s)	22, 39, 235, 355, 454, 499
BstMAI	GTCTC	2 cut(s)	163, 386
BstMBI	GATC	6 cut(s)	19, 36, 232, 352, 451, 496
BstMWI	GCNNNNNNNGC	1 cut(s)	202
BstSFI	CTRYAG	2 cut(s)	194, 281
BstV1I	GCAGC	1 cut(s)	357
BstX2I	RGATCY	1 cut(s)	496
BstYI	RGATCY	1 cut(s)	496
BsuRI	GGCC	2 cut(s)	168, 261
BveI	ACCTGC	1 cut(s)	288
Cac8I	GCNNGC	2 cut(s)	240, 285
Cfr13I	GGNCC	2 cut(s)	167, 260
Csp6I	GTAC	1 cut(s)	277
CviAII	CATG	2 cut(s)	443, 471
CviJI	RGCY	8 cut(s)	77, 89, 148, 168, 261, 287, 481, 564
CviKI_1	RGCY	8 cut(s)	77, 89, 148, 168, 261, 287, 481, 564
CviQI	GTAC	1 cut(s)	277
DpnI	GATC	6 cut(s)	21, 38, 234, 354, 453, 498
DpnII	GATC	6 cut(s)	19, 36, 232, 352, 451, 496
Eam1104I	CTCTTC	2 cut(s)	389, 404
EarI	CTCTTC	2 cut(s)	389, 404
Eco31I	GGTCTC	1 cut(s)	386
Eco32I	GATATC	1 cut(s)	224
Eco57I	CTGAAG	1 cut(s)	85
EcoRI	GAATTC	1 cut(s)	410
EcoRV	GATATC	1 cut(s)	224
FaeI	CATG	2 cut(s)	446, 474
FaiI	YATR	6 cut(s)	35, 180, 311, 444, 472, 491
FatI	CATG	2 cut(s)	442, 470
Fnu4HI	GCNGC	2 cut(s)	346, 349
Fsp4HI	GCNGC	2 cut(s)	346, 349
FspBI	CTAG	3 cut(s)	356, 374, 422
GluI	GCNGC	2 cut(s)	346, 349
HaeIII	GGCC	2 cut(s)	168, 261
Hin1II	CATG	2 cut(s)	446, 474
HindIII	AAGCTT	1 cut(s)	562
HinfI	GANTC	2 cut(s)	293, 439
HphI	GGTGA	3 cut(s)	59, 458, 487
Hpy188I	TCNGA	2 cut(s)	104, 456
HpyCH4III	ACNGT	1 cut(s)	380
HpyCH4IV	ACGT	1 cut(s)	153
HpyCH4V	TGCA	5 cut(s)	96, 196, 205, 283, 405
HpyF10VI	GCNNNNNNNGC	1 cut(s)	202
HpySE526I	ACGT	1 cut(s)	153
Hsp92II	CATG	2 cut(s)	446, 474
Kzo9I	GATC	6 cut(s)	19, 36, 232, 352, 451, 496
LmnI	GCTCC	1 cut(s)	208
LpnPI	CCDG	7 cut(s)	30, 63, 158, 191, 269, 293, 518
Lsp1109I	GCAGC	1 cut(s)	357
LweI	GCATC	2 cut(s)	105, 192
MaeI	CTAG	3 cut(s)	356, 374, 422
MaeII	ACGT	1 cut(s)	153
MaeIII	GTNAC	1 cut(s)	446
MalI	GATC	6 cut(s)	21, 38, 234, 354, 453, 498
MboI	GATC	6 cut(s)	19, 36, 232, 352, 451, 496
MboII	GAAGA	5 cut(s)	91, 340, 376, 391, 527
MfeI	CAATTG	1 cut(s)	255
MflI	RGATCY	1 cut(s)	496
MhlI	GDGCHC	1 cut(s)	213
MluCI	AATT	3 cut(s)	255, 410, 519
MlyI	GAGTC	1 cut(s)	448
MmeI	TCCRAC	1 cut(s)	489
MnlI	CCTC	4 cut(s)	5, 79, 159, 512
MseI	TTAA	1 cut(s)	462
MspA1I	CMGCKG	2 cut(s)	77, 348
MunI	CAATTG	1 cut(s)	255
MwoI	GCNNNNNNNGC	1 cut(s)	202
NdeII	GATC	6 cut(s)	19, 36, 232, 352, 451, 496
NlaIII	CATG	2 cut(s)	446, 474
NmuCI	GTSAC	1 cut(s)	446
NspV	TTCGAA	1 cut(s)	326
PfeI	GAWTC	1 cut(s)	293
PflMI	CCANNNNNTGG	1 cut(s)	77
PkrI	GCNGC	2 cut(s)	347, 350
PleI	GAGTC	1 cut(s)	447
PpsI	GAGTC	1 cut(s)	447
Ppu21I	YACGTR	1 cut(s)	154
PspPI	GGNCC	2 cut(s)	167, 260
PstI	CTGCAG	2 cut(s)	198, 285
PsuI	RGATCY	1 cut(s)	496
PvuII	CAGCTG	1 cut(s)	77
RsaI	GTAC	1 cut(s)	278
RsaNI	GTAC	1 cut(s)	277
SaqAI	TTAA	1 cut(s)	462
SatI	GCNGC	2 cut(s)	346, 349
Sau3AI	GATC	6 cut(s)	19, 36, 232, 352, 451, 496
Sau96I	GGNCC	2 cut(s)	167, 260
SbfI	CCTGCAGG	1 cut(s)	285
SchI	GAGTC	1 cut(s)	448
SdaI	CCTGCAGG	1 cut(s)	285
SduI	GDGCHC	1 cut(s)	213
SetI	ASST	5 cut(s)	79, 143, 156, 282, 566
SfaNI	GCATC	2 cut(s)	105, 192
SfcI	CTRYAG	2 cut(s)	194, 281
SfuI	TTCGAA	1 cut(s)	326
SpeI	ACTAGT	1 cut(s)	421
Sse8387I	CCTGCAGG	1 cut(s)	285
Sse9I	AATT	3 cut(s)	255, 410, 519
SsiI	CCGC	1 cut(s)	348
SspMI	CTAG	3 cut(s)	356, 374, 422
TaaI	ACNGT	1 cut(s)	380
TaiI	ACGT	1 cut(s)	156
TaqI	TCGA	4 cut(s)	39, 244, 326, 393
TasI	AATT	3 cut(s)	255, 410, 519
TauI	GCSGC	1 cut(s)	351
TfiI	GAWTC	1 cut(s)	293
Tru1I	TTAA	1 cut(s)	462
Tru9I	TTAA	1 cut(s)	462
TseFI	GTSAC	1 cut(s)	446
TseI	GCWGC	1 cut(s)	345
Tsp45I	GTSAC	1 cut(s)	446
TspDTI	ATGAA	1 cut(s)	376
Van91I	CCANNNNNTGG	1 cut(s)	77
XapI	RAATTY	2 cut(s)	410, 519
XspI	CTAG	3 cut(s)	356, 374, 422

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.