Rmu_sc0007763.1_g000001

HAUS augmin-like complex subunit 2

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007763.1
Physical Location & Seq
Reverse (-)
1234 .. 1575
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007763.1_g000001.1.cds

Sequence Viewer

Length: 342 bp
atgcttcgtccaattcctgttgccttagcatcatgcacccggttttttgaagcaatatctgctatgagggaatcgtttgcaacacttcaacatctcagagtaggtcattctgataccgcttcacctatcacaccagccaaggaatccagaagagtaccaggggtttccgattgtgtaactccgcctccctggaaaactgaaccaagctttgatgacttagctatcaaaagctcaagaaggccggatatcaagcatcaagaagcagaggatgaaagtgagctggacggctctagccataggagattgtcatggcctccttcgattaaaaaggctgctacttaa

Protein Analysis

113

Amino Acids

12.52

Weight (kDa)

7.86

Isoelectric Point (pI)

72.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 117, 182
AfaI GTAC 1 cut(s) 156
AgsI TTSAA 2 cut(s) 50, 89
AjnI CCWGG 2 cut(s) 157, 188
AluBI AGCT 4 cut(s) 207, 221, 231, 280
AluI AGCT 4 cut(s) 207, 221, 231, 280
AoxI GGCC 2 cut(s) 239, 311
ApeKI GCWGC 1 cut(s) 332
AsuC2I CCSGG 1 cut(s) 40
AsuHPI GGTGA 1 cut(s) 114
BbvI GCAGC 1 cut(s) 319
BceAI ACGGC 1 cut(s) 301
BciT130I CCWGG 2 cut(s) 159, 190
BcnI CCSGG 1 cut(s) 40
BfaI CTAG 1 cut(s) 291
BisI GCNGC 1 cut(s) 333
BlsI GCNGC 1 cut(s) 334
Bme1390I CCNGG 3 cut(s) 40, 159, 190
BmrFI CCNGG 3 cut(s) 40, 159, 190
BmsI GCATC 2 cut(s) 38, 262
Bpu10I CCTNAGC 1 cut(s) 25
BpuEI CTTGAG 1 cut(s) 217
BpuMI CCSGG 1 cut(s) 40
BsaJI CCNNGG 3 cut(s) 138, 158, 188
BsaXI ACNNNNNCTCC 2 cut(s) 169, 199
BseBI CCWGG 2 cut(s) 159, 190
BseDI CCNNGG 3 cut(s) 138, 158, 188
BseGI GGATG 1 cut(s) 274
BseMII CTCAG 1 cut(s) 109
BseXI GCAGC 1 cut(s) 319
BshFI GGCC 2 cut(s) 241, 313
BsiSI CCGG 2 cut(s) 40, 242
BsnI GGCC 2 cut(s) 241, 313
BspACI CCGC 2 cut(s) 117, 182
BspANI GGCC 2 cut(s) 241, 313
BspCNI CTCAG 1 cut(s) 108
BssECI CCNNGG 3 cut(s) 138, 158, 188
BssT1I CCWWGG 1 cut(s) 138
Bst2UI CCWGG 2 cut(s) 159, 190
Bst6I CTCTTC 1 cut(s) 145
BstAPI GCANNNNNTGC 1 cut(s) 59
BstDEI CTNAG 3 cut(s) 25, 95, 217
BstF5I GGATG 1 cut(s) 274
BstMWI GCNNNNNNNGC 1 cut(s) 59
BstNI CCWGG 2 cut(s) 159, 190
BstSCI CCNGG 3 cut(s) 38, 157, 188
BstV1I GCAGC 1 cut(s) 319
BsuRI GGCC 2 cut(s) 241, 313
BtsCI GGATG 1 cut(s) 274
Csp6I GTAC 1 cut(s) 155
CviAII CATG 2 cut(s) 33, 309
CviQI GTAC 1 cut(s) 155
DdeI CTNAG 3 cut(s) 25, 95, 217
Eam1104I CTCTTC 1 cut(s) 145
EarI CTCTTC 1 cut(s) 145
EciI GGCGGA 1 cut(s) 171
Eco130I CCWWGG 1 cut(s) 138
Eco32I GATATC 1 cut(s) 247
EcoRII CCWGG 2 cut(s) 157, 188
EcoRV GATATC 1 cut(s) 247
EcoT14I CCWWGG 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 138
FaeI CATG 2 cut(s) 36, 312
FaiI YATR 4 cut(s) 34, 65, 297, 310
FatI CATG 2 cut(s) 32, 308
Fnu4HI GCNGC 1 cut(s) 333
FokI GGATG 1 cut(s) 281
Fsp4HI GCNGC 1 cut(s) 333
FspBI CTAG 1 cut(s) 291
GluI GCNGC 1 cut(s) 333
HaeIII GGCC 2 cut(s) 241, 313
HapII CCGG 2 cut(s) 40, 242
Hin1II CATG 2 cut(s) 36, 312
HindIII AAGCTT 1 cut(s) 205
HinfI GANTC 2 cut(s) 71, 143
HpaII CCGG 2 cut(s) 40, 242
HphI GGTGA 1 cut(s) 114
Hpy188I TCNGA 3 cut(s) 98, 112, 169
Hpy188III TCNNGA 3 cut(s) 147, 234, 257
HpyAV CCTTC 2 cut(s) 231, 327
HpyCH4V TGCA 2 cut(s) 36, 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 59
HpyF3I CTNAG 3 cut(s) 25, 95, 217
Hsp92II CATG 2 cut(s) 36, 312
Lsp1109I GCAGC 1 cut(s) 319
LweI GCATC 2 cut(s) 38, 262
MaeI CTAG 1 cut(s) 291
MaeIII GTNAC 1 cut(s) 175
MboII GAAGA 1 cut(s) 162
MluCI AATT 1 cut(s) 12
MnlI CCTC 4 cut(s) 60, 195, 259, 324
MseI TTAA 2 cut(s) 324, 340
MspI CCGG 2 cut(s) 40, 242
MspR9I CCNGG 3 cut(s) 40, 159, 190
MvaI CCWGG 2 cut(s) 159, 190
MwoI GCNNNNNNNGC 1 cut(s) 59
NciI CCSGG 1 cut(s) 40
NlaIII CATG 2 cut(s) 36, 312
PfeI GAWTC 2 cut(s) 71, 143
PkrI GCNGC 1 cut(s) 334
Psp6I CCWGG 2 cut(s) 157, 188
PspGI CCWGG 2 cut(s) 157, 188
RsaI GTAC 1 cut(s) 156
RsaNI GTAC 1 cut(s) 155
SaqAI TTAA 2 cut(s) 324, 340
SatI GCNGC 1 cut(s) 333
ScrFI CCNGG 3 cut(s) 40, 159, 190
SetI ASST 6 cut(s) 106, 127, 209, 223, 233, 282
SfaNI GCATC 2 cut(s) 38, 262
SmlI CTYRAG 1 cut(s) 232
SmoI CTYRAG 1 cut(s) 232
Sse9I AATT 1 cut(s) 12
SsiI CCGC 2 cut(s) 117, 182
SspMI CTAG 1 cut(s) 291
StyD4I CCNGG 3 cut(s) 38, 157, 188
StyI CCWWGG 1 cut(s) 138
TaqI TCGA 1 cut(s) 320
TasI AATT 1 cut(s) 12
TfiI GAWTC 2 cut(s) 71, 143
Tru1I TTAA 2 cut(s) 324, 340
Tru9I TTAA 2 cut(s) 324, 340
TseI GCWGC 1 cut(s) 332
TspDTI ATGAA 1 cut(s) 285
XspI CTAG 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.