Rh1CG094800

HAUS augmin-like complex subunit 2

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
20270077 .. 20270575
499 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG094800.1

Sequence Viewer

Length: 276 bp
ATGTGTTATGATAAAAATGTTTCACATTTGACACATTCTTCTGCTGTATGTTGGATTCCCATCACACCAGCCAAGGATTCCAGAAGAGTACCAGGGGTTTCTGATTGTGTAACTCCACCTCCCTGGAAATCTGAACCAAGCTTTGATGACTTGGCTATCAAAAGCTCAAGAAGGTCAGATATCAAGCATCAAGAAGCAGAGGATGAAAGTGAGCTGGACGGCTCTAGCCATAGGAGATTGTCATGGCCTCCTTCAGTTGAAAATGCTGCTACTTAA

Protein Analysis

91

Amino Acids

10.13

Weight (kDa)

5.72

Isoelectric Point (pI)

75.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 237
AfaI GTAC 1 cut(s) 90
AgsI TTSAA 1 cut(s) 260
AjnI CCWGG 2 cut(s) 91, 122
AluBI AGCT 3 cut(s) 141, 165, 214
AluI AGCT 3 cut(s) 141, 165, 214
AoxI GGCC 1 cut(s) 245
ApeKI GCWGC 1 cut(s) 266
BbvI GCAGC 1 cut(s) 253
BccI CCATC 1 cut(s) 68
BceAI ACGGC 1 cut(s) 235
BciT130I CCWGG 2 cut(s) 93, 124
BfaI CTAG 1 cut(s) 225
BisI GCNGC 1 cut(s) 267
BlsI GCNGC 1 cut(s) 268
Bme1390I CCNGG 2 cut(s) 93, 124
BmrFI CCNGG 2 cut(s) 93, 124
BmsI GCATC 1 cut(s) 196
BpuEI CTTGAG 1 cut(s) 151
BsaBI GATNNNNATC 1 cut(s) 59
BsaJI CCNNGG 3 cut(s) 72, 92, 122
BsaXI ACNNNNNCTCC 2 cut(s) 103, 133
Bse8I GATNNNNATC 1 cut(s) 59
BseBI CCWGG 2 cut(s) 93, 124
BseDI CCNNGG 3 cut(s) 72, 92, 122
BseGI GGATG 1 cut(s) 208
BseJI GATNNNNATC 1 cut(s) 59
BseXI GCAGC 1 cut(s) 253
BshFI GGCC 1 cut(s) 247
BsnI GGCC 1 cut(s) 247
BspANI GGCC 1 cut(s) 247
BssECI CCNNGG 3 cut(s) 72, 92, 122
BssT1I CCWWGG 1 cut(s) 72
Bst2UI CCWGG 2 cut(s) 93, 124
Bst6I CTCTTC 1 cut(s) 79
BstF5I GGATG 1 cut(s) 208
BstNI CCWGG 2 cut(s) 93, 124
BstSCI CCNGG 2 cut(s) 91, 122
BstV1I GCAGC 1 cut(s) 253
BstXI CCANNNNNNTGG 1 cut(s) 123
BsuRI GGCC 1 cut(s) 247
BtsCI GGATG 1 cut(s) 208
Csp6I GTAC 1 cut(s) 89
CviAII CATG 1 cut(s) 243
CviJI RGCY 8 cut(s) 71, 141, 155, 165, 214, 222, 228, 247
CviKI_1 RGCY 8 cut(s) 71, 141, 155, 165, 214, 222, 228, 247
CviQI GTAC 1 cut(s) 89
Eam1104I CTCTTC 1 cut(s) 79
EarI CTCTTC 1 cut(s) 79
Eco130I CCWWGG 1 cut(s) 72
Eco32I GATATC 1 cut(s) 181
Eco57I CTGAAG 1 cut(s) 237
EcoRII CCWGG 2 cut(s) 91, 122
EcoRV GATATC 1 cut(s) 181
EcoT14I CCWWGG 1 cut(s) 72
ErhI CCWWGG 1 cut(s) 72
FaeI CATG 1 cut(s) 246
FaiI YATR 4 cut(s) 9, 49, 231, 244
FatI CATG 1 cut(s) 242
Fnu4HI GCNGC 1 cut(s) 267
FokI GGATG 1 cut(s) 215
Fsp4HI GCNGC 1 cut(s) 267
FspBI CTAG 1 cut(s) 225
GluI GCNGC 1 cut(s) 267
HaeIII GGCC 1 cut(s) 247
Hin1II CATG 1 cut(s) 246
HindIII AAGCTT 1 cut(s) 139
HinfI GANTC 2 cut(s) 55, 77
Hpy188I TCNGA 3 cut(s) 103, 133, 178
Hpy188III TCNNGA 3 cut(s) 81, 168, 191
HpyAV CCTTC 2 cut(s) 165, 261
Hsp92II CATG 1 cut(s) 246
LpnPI CCDG 7 cut(s) 78, 81, 94, 105, 109, 136, 200
Lsp1109I GCAGC 1 cut(s) 253
LweI GCATC 1 cut(s) 196
MaeI CTAG 1 cut(s) 225
MaeIII GTNAC 1 cut(s) 109
MboII GAAGA 2 cut(s) 30, 96
MmeI TCCRAC 1 cut(s) 32
MnlI CCTC 3 cut(s) 129, 193, 258
MseI TTAA 1 cut(s) 274
MspR9I CCNGG 2 cut(s) 93, 124
MvaI CCWGG 2 cut(s) 93, 124
NlaIII CATG 1 cut(s) 246
PfeI GAWTC 2 cut(s) 55, 77
PkrI GCNGC 1 cut(s) 268
Psp6I CCWGG 2 cut(s) 91, 122
PspGI CCWGG 2 cut(s) 91, 122
RsaI GTAC 1 cut(s) 90
RsaNI GTAC 1 cut(s) 89
SaqAI TTAA 1 cut(s) 274
SatI GCNGC 1 cut(s) 267
ScrFI CCNGG 2 cut(s) 93, 124
SetI ASST 5 cut(s) 121, 143, 167, 176, 216
SfaNI GCATC 1 cut(s) 196
SmlI CTYRAG 1 cut(s) 166
SmoI CTYRAG 1 cut(s) 166
SspMI CTAG 1 cut(s) 225
StyD4I CCNGG 2 cut(s) 91, 122
StyI CCWWGG 1 cut(s) 72
TfiI GAWTC 2 cut(s) 55, 77
Tru1I TTAA 1 cut(s) 274
Tru9I TTAA 1 cut(s) 274
TseI GCWGC 1 cut(s) 266
TspDTI ATGAA 1 cut(s) 219
XspI CTAG 1 cut(s) 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.