Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014758.1

Orthogroup ID

OG0001321

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 743

Gene Structure 743 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014758.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 743 bp

attccgggagatatcgacctgatttcgtcgtctctacaatacttgaacctcggcgggaacaacttctccggcgacgttccggcggctatcggaaacctaacggagctgaaggccttgcagctttactcaaatctgttcaacggaacagttccgagggagataggcaacttgttgaatctcgagatcttaaacatttcgttcaacggtgatctgatcgctgcgcaaatcccgccggagttcggaaagttggagaagctgaagggattccggatgagggcgtcgaagttgatcggtccaatcccggctactttctctaatcttgtgagcctccaggagcttgatcttgcctataacaatttggaaggcaagattcctgatggcttgtttttgttgaaggatttgagaattttgtatctattccgcaatagattgaccggagagataccgatcaccgttgaagcattgagtttggcagaagttgaccttgctatgaacaacttgaccggctcaattccaccggatttcggcaagctgagcaacctgactgtcttgaatttgtactcgaatcaactaacgggtggaattcctacgagtttaggccttatttcgacgctgaggggctttcgggttttcaagaacaagctgaatgggactttgccgccggagttgggtcttaactcggagcttgaaggattcgaggtttcggagaatcagctgagtggcgcactgccggagcatctgtg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_6 LRR_8 Pkinase

Protein Analysis

247

Amino Acids

26.76

Weight (kDa)

4.83

Isoelectric Point (pI)

22.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001321)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G25930
fragaria_vesca	FvH4_1g06180 FvH4_1g06180 FvH4_1g06220 FvH4_1g06260 FvH4_1g07450 FvH4_1g07450 FvH4_1g07450 FvH4_2g35260
malus_domestica	MD02G1066200.v1.1 MD02G1066300.v1.1 MD02G1066400.v1.1 MD08G1110500.v1.1 MD15G1196900.v1.1
prunus_persica	Prupe.1G444700_v2.0.a1 Prupe.7G218900_v2.0.a1 Prupe.7G219100_v2.0.a1 Prupe.7G219300_v2.0.a1 Prupe.7G219300_v2.0.a1 Prupe.7G219400_v2.0.a1 Prupe.7G219500_v2.0.a1
pyrus_communis	pycom02g05250 pycom08g08890 pycom08g09200 pycom15g08430 pycom15g17590
rosa_chinensis	RchiOBHm_Chr2g0091961 RchiOBHm_Chr6g0306681
rosa_laevigata	RLG00000010774 RLG00000016262 RLG00000016266
rosa_multiflora	Rmu_co7980064.1_g000001 Rmu_sc0005201.1_g000003 Rmu_sc0009216.1_g000004 Rmu_sc0014758.1_g000001 Rmu_sc0017125.1_g000005 Rmu_sc0017648.1_g000001 Rmu_sc0017649.1_g000001 Rmu_sc0017785.1_g000010 Rmu_sc0017785.1_g000011
rosa_roxburghii	Rroxscaffold_2G00149580 Rroxscaffold_7G00161550
rosa_rugosa	Rorug02G0022000 Rorug06G0351600
rosa_samantha	Rh2AG067500 Rh2BG066800 Rh2CG068100 Rh2DG066600 Rh6AG463900 Rh6BG437100 Rh6CG478000 Rh6DG464800
rosa_wichuraiana	Rw2G005350 Rw6G040410

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	222
AccIII	TCCGGA	1 cut(s)	267
AciI	CCGC	5 cut(s)	54, 83, 230, 421, 659
AcsI	RAATTY	3 cut(s)	405, 553, 582
AcuI	CTGAAG	2 cut(s)	128, 278
AcyI	GRCGYC	1 cut(s)	278
AfaI	GTAC	1 cut(s)	560
AfiI	CCNNNNNNNGG	4 cut(s)	239, 274, 524, 668
AgsI	TTSAA	9 cut(s)	46, 139, 175, 202, 394, 458, 553, 634, 689
AjnI	CCWGG	1 cut(s)	330
AloI	GAACNNNNNNTCC	2 cut(s)	50, 82
AluBI	AGCT	8 cut(s)	106, 121, 256, 337, 532, 643, 685, 715
AluI	AGCT	8 cut(s)	106, 121, 256, 337, 532, 643, 685, 715
Alw26I	GTCTC	1 cut(s)	36
Ama87I	CYCGRG	1 cut(s)	179
Aor13HI	TCCGGA	1 cut(s)	267
AoxI	GGCC	2 cut(s)	111, 598
ApeKI	GCWGC	2 cut(s)	118, 218
ApoI	RAATTY	3 cut(s)	405, 553, 582
Asp700I	GAANNNNTTC	2 cut(s)	62, 263
AspLEI	GCGC	2 cut(s)	223, 725
AspS9I	GGNCC	1 cut(s)	293
AsuC2I	CCSGG	2 cut(s)	6, 302
AsuHPI	GGTGA	2 cut(s)	218, 442
AvaI	CYCGRG	1 cut(s)	179
AvaII	GGWCC	1 cut(s)	293
BbvCI	CCTCAGC	1 cut(s)	614
BbvI	GCAGC	2 cut(s)	130, 205
BccI	CCATC	1 cut(s)	371
BciT130I	CCWGG	1 cut(s)	332
BcnI	CCSGG	2 cut(s)	6, 302
BcoDI	GTCTC	1 cut(s)	36
BglII	AGATCT	1 cut(s)	183
BisI	GCNGC	4 cut(s)	84, 119, 219, 659
BlpI	GCTNAGC	1 cut(s)	533
BlsI	GCNGC	4 cut(s)	85, 120, 220, 660
Bme1390I	CCNGG	3 cut(s)	6, 302, 332
Bme18I	GGWCC	1 cut(s)	293
BmeT110I	CYCGRG	1 cut(s)	179
BmgT120I	GGNCC	1 cut(s)	293
BmrFI	CCNGG	3 cut(s)	6, 302, 332
BpmI	CTGGAG	1 cut(s)	314
Bpu10I	CCTNAGC	1 cut(s)	614
Bpu1102I	GCTNAGC	1 cut(s)	533
BpuMI	CCSGG	2 cut(s)	6, 302
BsaBI	GATNNNNATC	1 cut(s)	446
BsaHI	GRCGYC	1 cut(s)	278
BsaJI	CCNNGG	2 cut(s)	49, 152
BsaWI	WCCGGW	3 cut(s)	267, 434, 517
BsaXI	ACNNNNNCTCC	3 cut(s)	50, 80, 725
Bsc4I	CCNNNNNNNGG	4 cut(s)	239, 274, 524, 668
Bse118I	RCCGGY	1 cut(s)	503
Bse8I	GATNNNNATC	1 cut(s)	446
BseAI	TCCGGA	1 cut(s)	267
BseBI	CCWGG	1 cut(s)	332
BseDI	CCNNGG	2 cut(s)	49, 152
BseGI	GGATG	1 cut(s)	276
BseJI	GATNNNNATC	1 cut(s)	446
BseLI	CCNNNNNNNGG	4 cut(s)	239, 274, 524, 668
BseMII	CTCAG	3 cut(s)	524, 605, 707
BseXI	GCAGC	2 cut(s)	130, 205
BshFI	GGCC	2 cut(s)	113, 600
BsiHKCI	CYCGRG	1 cut(s)	179
BslFI	GGGAC	1 cut(s)	664
BslI	CCNNNNNNNGG	4 cut(s)	239, 274, 524, 668
BsmAI	GTCTC	1 cut(s)	36
BsmBI	CGTCTC	1 cut(s)	36
BsmFI	GGGAC	1 cut(s)	664
BsnI	GGCC	2 cut(s)	113, 600
BsoBI	CYCGRG	1 cut(s)	179
Bsp13I	TCCGGA	1 cut(s)	267
Bsp143I	GATC	6 cut(s)	183, 208, 213, 288, 340, 447
Bsp1720I	GCTNAGC	1 cut(s)	533
BspACI	CCGC	5 cut(s)	54, 83, 230, 421, 659
BspANI	GGCC	2 cut(s)	113, 600
BspCNI	CTCAG	3 cut(s)	525, 606, 708
BspEI	TCCGGA	1 cut(s)	267
BsrFI	RCCGGY	1 cut(s)	503
BssAI	RCCGGY	1 cut(s)	503
BssECI	CCNNGG	2 cut(s)	49, 152
BssMI	GATC	6 cut(s)	183, 208, 213, 288, 340, 447
BssNI	GRCGYC	1 cut(s)	278
Bst2UI	CCWGG	1 cut(s)	332
Bst4CI	ACNGT	4 cut(s)	148, 206, 454, 547
BstACI	GRCGYC	1 cut(s)	278
BstC8I	GCNNGC	1 cut(s)	530
BstDEI	CTNAG	3 cut(s)	533, 614, 716
BstF5I	GGATG	1 cut(s)	276
BstHHI	GCGC	2 cut(s)	223, 725
BstKTI	GATC	6 cut(s)	186, 211, 216, 291, 343, 450
BstMAI	GTCTC	1 cut(s)	36
BstMBI	GATC	6 cut(s)	183, 208, 213, 288, 340, 447
BstMWI	GCNNNNNNNGC	2 cut(s)	229, 534
BstNI	CCWGG	1 cut(s)	332
BstSCI	CCNGG	3 cut(s)	4, 300, 330
BstV1I	GCAGC	2 cut(s)	130, 205
BstX2I	RGATCY	1 cut(s)	183
BstYI	RGATCY	1 cut(s)	183
BsuRI	GGCC	2 cut(s)	113, 600
BtsCI	GGATG	1 cut(s)	276
BtsI	GCAGTG	1 cut(s)	725
BtsIMutI	CAGTG	1 cut(s)	725
Cac8I	GCNNGC	1 cut(s)	530
CfoI	GCGC	2 cut(s)	223, 725
Cfr10I	RCCGGY	1 cut(s)	503
Cfr13I	GGNCC	1 cut(s)	293
CseI	GACGC	2 cut(s)	267, 619
Csp6I	GTAC	1 cut(s)	559
CviQI	GTAC	1 cut(s)	559
DdeI	CTNAG	3 cut(s)	533, 614, 716
DpnI	GATC	6 cut(s)	185, 210, 215, 290, 342, 449
DpnII	GATC	6 cut(s)	183, 208, 213, 288, 340, 447
Eco147I	AGGCCT	2 cut(s)	113, 600
Eco32I	GATATC	1 cut(s)	13
Eco47I	GGWCC	1 cut(s)	293
Eco57I	CTGAAG	2 cut(s)	128, 278
Eco88I	CYCGRG	1 cut(s)	179
EcoRI	GAATTC	1 cut(s)	582
EcoRII	CCWGG	1 cut(s)	330
EcoRV	GATATC	1 cut(s)	13
Esp3I	CGTCTC	1 cut(s)	36
FaiI	YATR	2 cut(s)	351, 491
FalI	AAGNNNNNCTT	2 cut(s)	468, 500
FaqI	GGGAC	1 cut(s)	664
FauI	CCCGC	2 cut(s)	47, 237
Fnu4HI	GCNGC	4 cut(s)	84, 119, 219, 659
FokI	GGATG	1 cut(s)	283
Fsp4HI	GCNGC	4 cut(s)	84, 119, 219, 659
FspI	TGCGCA	1 cut(s)	222
GlaI	GCGC	2 cut(s)	222, 724
GluI	GCNGC	4 cut(s)	84, 119, 219, 659
GsuI	CTGGAG	1 cut(s)	314
HaeIII	GGCC	2 cut(s)	113, 600
HgaI	GACGC	2 cut(s)	267, 619
HhaI	GCGC	2 cut(s)	223, 725
Hin1I	GRCGYC	1 cut(s)	278
Hin6I	GCGC	2 cut(s)	221, 723
HinP1I	GCGC	2 cut(s)	221, 723
HincII	GTYRAC	1 cut(s)	481
HindII	GTYRAC	1 cut(s)	481
HinfI	GANTC	6 cut(s)	175, 264, 370, 565, 693, 709
HphI	GGTGA	2 cut(s)	218, 442
Hpy166II	GTNNAC	1 cut(s)	481
Hpy188I	TCNGA	6 cut(s)	92, 153, 213, 242, 682, 706
Hpy188III	TCNNGA	6 cut(s)	179, 181, 268, 374, 550, 634
Hpy8I	GTNNAC	1 cut(s)	481
Hpy99I	CGWCG	4 cut(s)	31, 77, 283, 613
HpyAV	CCTTC	5 cut(s)	103, 253, 356, 388, 683
HpyCH4III	ACNGT	4 cut(s)	148, 206, 454, 547
HpyCH4IV	ACGT	1 cut(s)	75
HpyCH4V	TGCA	1 cut(s)	118
HpyF10VI	GCNNNNNNNGC	2 cut(s)	229, 534
HpyF3I	CTNAG	3 cut(s)	533, 614, 716
HpySE526I	ACGT	1 cut(s)	75
Hsp92I	GRCGYC	1 cut(s)	278
HspAI	GCGC	2 cut(s)	221, 723
Kpn2I	TCCGGA	1 cut(s)	267
Kzo9I	GATC	6 cut(s)	183, 208, 213, 288, 340, 447
LmnI	GCTCC	4 cut(s)	103, 334, 682, 733
Lsp1109I	GCAGC	2 cut(s)	130, 205
MaeII	ACGT	1 cut(s)	75
MalI	GATC	6 cut(s)	185, 210, 215, 290, 342, 449
MboI	GATC	6 cut(s)	183, 208, 213, 288, 340, 447
MflI	RGATCY	1 cut(s)	183
MluCI	AATT	5 cut(s)	355, 405, 510, 553, 582
MmeI	TCCRAC	1 cut(s)	228
MnlI	CCTC	6 cut(s)	59, 147, 267, 338, 609, 691
MroI	TCCGGA	1 cut(s)	267
MroXI	GAANNNNTTC	2 cut(s)	62, 263
MseI	TTAA	2 cut(s)	188, 675
MspA1I	CMGCKG	1 cut(s)	715
MspR9I	CCNGG	3 cut(s)	6, 302, 332
MvaI	CCWGG	1 cut(s)	332
MwoI	GCNNNNNNNGC	2 cut(s)	229, 534
NciI	CCSGG	2 cut(s)	6, 302
NdeII	GATC	6 cut(s)	183, 208, 213, 288, 340, 447
NmeAIII	GCCGAG	1 cut(s)	30
NsbI	TGCGCA	1 cut(s)	222
PaeR7I	CTCGAG	1 cut(s)	179
PceI	AGGCCT	2 cut(s)	113, 600
PdmI	GAANNNNTTC	2 cut(s)	62, 263
PfeI	GAWTC	6 cut(s)	175, 264, 370, 565, 693, 709
PfoI	TCCNGGA	2 cut(s)	4, 330
PkrI	GCNGC	4 cut(s)	85, 120, 220, 660
Psp6I	CCWGG	1 cut(s)	330
PspGI	CCWGG	1 cut(s)	330
PspPI	GGNCC	1 cut(s)	293
PsuI	RGATCY	1 cut(s)	183
PvuII	CAGCTG	1 cut(s)	715
RsaI	GTAC	1 cut(s)	560
RsaNI	GTAC	1 cut(s)	559
SaqAI	TTAA	2 cut(s)	188, 675
SatI	GCNGC	4 cut(s)	84, 119, 219, 659
Sau3AI	GATC	6 cut(s)	183, 208, 213, 288, 340, 447
Sau96I	GGNCC	1 cut(s)	293
ScrFI	CCNGG	3 cut(s)	6, 302, 332
Sfr274I	CTCGAG	1 cut(s)	179
SinI	GGWCC	1 cut(s)	293
SlaI	CTCGAG	1 cut(s)	179
SmlI	CTYRAG	1 cut(s)	179
SmoI	CTYRAG	1 cut(s)	179
Sse9I	AATT	5 cut(s)	355, 405, 510, 553, 582
SseBI	AGGCCT	2 cut(s)	113, 600
SsiI	CCGC	5 cut(s)	54, 83, 230, 421, 659
StuI	AGGCCT	2 cut(s)	113, 600
StyD4I	CCNGG	3 cut(s)	4, 300, 330
TaaI	ACNGT	4 cut(s)	148, 206, 454, 547
TaiI	ACGT	1 cut(s)	78
TaqI	TCGA	6 cut(s)	15, 180, 281, 563, 608, 696
TaqII	GACCGA	1 cut(s)	281
TasI	AATT	5 cut(s)	355, 405, 510, 553, 582
TatI	WGTACW	1 cut(s)	558
TauI	GCSGC	2 cut(s)	86, 661
TfiI	GAWTC	6 cut(s)	175, 264, 370, 565, 693, 709
Tru1I	TTAA	2 cut(s)	188, 675
Tru9I	TTAA	2 cut(s)	188, 675
TscAI	CASTG	1 cut(s)	732
TseI	GCWGC	2 cut(s)	118, 218
TspDTI	ATGAA	1 cut(s)	506
TspGWI	ACGGA	2 cut(s)	116, 156
TspRI	CASTG	1 cut(s)	732
VpaK11BI	GGWCC	1 cut(s)	293
XapI	RAATTY	3 cut(s)	405, 553, 582
XhoI	CTCGAG	1 cut(s)	179
XmnI	GAANNNNTTC	2 cut(s)	62, 263

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.