Rmu_sc0019528.1_g000001

B3 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019528.1
Physical Location & Seq
Reverse (-)
2 .. 313
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019528.1_g000001.1.cds

Sequence Viewer

Length: 312 bp
atgttgggtcacactgataagatactgaggttgtctctgcggaagccatgggtggataaggatgtgctcccaaacatgtctcaattagccaaggaccagatgaaccagggtcataggacaatggtccaagtatttgattctgacacgttgtctactcatgagttggcattcaggaaagcggaaagttttgtttttcgtggttcgtgggtgaaagattttgtgcataggagagacctggttgcacaggacgctattggtctttactggcagacggacaaacgaagatttgttttctctgttctcggaagctta

Protein Analysis

104

Amino Acids

12.16

Weight (kDa)

9.77

Isoelectric Point (pI)

30.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 152
AciI CCGC 2 cut(s) 40, 179
AflIII ACRYGT 2 cut(s) 75, 144
AhdI GACNNNNNGTC 1 cut(s) 148
AjnI CCWGG 2 cut(s) 105, 234
AluBI AGCT 1 cut(s) 309
AluI AGCT 1 cut(s) 309
Alw21I GWGCWC 1 cut(s) 69
Alw26I GTCTC 3 cut(s) 39, 84, 225
AspS9I GGNCC 2 cut(s) 94, 124
AsuHPI GGTGA 1 cut(s) 220
AvaII GGWCC 2 cut(s) 94, 124
BaeI ACNNNNGTAYC 2 cut(s) 14, 47
Bbv12I GWGCWC 1 cut(s) 69
BciT130I CCWGG 2 cut(s) 107, 236
BcoDI GTCTC 3 cut(s) 39, 84, 225
Bme1390I CCNGG 2 cut(s) 107, 236
Bme18I GGWCC 2 cut(s) 94, 124
BmeRI GACNNNNNGTC 1 cut(s) 148
BmgT120I GGNCC 2 cut(s) 94, 124
BmrFI CCNGG 2 cut(s) 107, 236
BoxI GACNNNNGTC 1 cut(s) 122
BplI GAGNNNNNCTC 2 cut(s) 19, 51
BsaI GGTCTC 1 cut(s) 225
BsaJI CCNNGG 3 cut(s) 47, 90, 106
Bse1I ACTGG 1 cut(s) 269
BseBI CCWGG 2 cut(s) 107, 236
BseDI CCNNGG 3 cut(s) 47, 90, 106
BseGI GGATG 1 cut(s) 67
BseMII CTCAG 1 cut(s) 17
BseNI ACTGG 1 cut(s) 269
BsiHKAI GWGCWC 1 cut(s) 69
BsmAI GTCTC 3 cut(s) 39, 84, 225
BsmI GAATGC 1 cut(s) 167
Bso31I GGTCTC 1 cut(s) 225
Bsp1286I GDGCHC 1 cut(s) 69
Bsp19I CCATGG 1 cut(s) 47
BspACI CCGC 2 cut(s) 40, 179
BspCNI CTCAG 1 cut(s) 18
BspHI TCATGA 1 cut(s) 157
BspTNI GGTCTC 1 cut(s) 225
BsrI ACTGG 1 cut(s) 269
BssECI CCNNGG 3 cut(s) 47, 90, 106
BssT1I CCWWGG 2 cut(s) 47, 90
Bst2UI CCWGG 2 cut(s) 107, 236
BstDEI CTNAG 1 cut(s) 26
BstDSI CCRYGG 1 cut(s) 47
BstF5I GGATG 1 cut(s) 67
BstMAI GTCTC 3 cut(s) 39, 84, 225
BstMWI GCNNNNNNNGC 1 cut(s) 248
BstNI CCWGG 2 cut(s) 107, 236
BstNSI RCATGY 1 cut(s) 79
BstPAI GACNNNNGTC 1 cut(s) 122
BstSCI CCNGG 2 cut(s) 105, 234
BtgI CCRYGG 1 cut(s) 47
BtsCI GGATG 1 cut(s) 67
BtsIMutI CAGTG 1 cut(s) 12
CciI TCATGA 1 cut(s) 157
Cfr13I GGNCC 2 cut(s) 94, 124
CseI GACGC 1 cut(s) 257
CsiI ACCWGGT 1 cut(s) 234
CviAII CATG 3 cut(s) 48, 76, 158
CviJI RGCY 3 cut(s) 46, 89, 309
CviKI_1 RGCY 3 cut(s) 46, 89, 309
DdeI CTNAG 1 cut(s) 26
DriI GACNNNNNGTC 1 cut(s) 148
Eam1105I GACNNNNNGTC 1 cut(s) 148
Eco130I CCWWGG 2 cut(s) 47, 90
Eco31I GGTCTC 1 cut(s) 225
Eco47I GGWCC 2 cut(s) 94, 124
EcoRII CCWGG 2 cut(s) 105, 234
EcoT14I CCWWGG 2 cut(s) 47, 90
ErhI CCWWGG 2 cut(s) 47, 90
FaeI CATG 3 cut(s) 51, 79, 161
FaiI YATR 5 cut(s) 49, 77, 114, 159, 225
FatI CATG 3 cut(s) 47, 75, 157
FblI GTMKAC 1 cut(s) 152
FokI GGATG 1 cut(s) 74
HgaI GACGC 1 cut(s) 257
Hin1II CATG 3 cut(s) 51, 79, 161
HindIII AAGCTT 1 cut(s) 307
HinfI GANTC 1 cut(s) 137
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 1 cut(s) 153
Hpy188I TCNGA 2 cut(s) 142, 305
Hpy188III TCNNGA 2 cut(s) 158, 172
Hpy8I GTNNAC 1 cut(s) 153
HpyCH4IV ACGT 1 cut(s) 146
HpyCH4V TGCA 2 cut(s) 223, 242
HpyF10VI GCNNNNNNNGC 1 cut(s) 248
HpyF3I CTNAG 1 cut(s) 26
HpySE526I ACGT 1 cut(s) 146
Hsp92II CATG 3 cut(s) 51, 79, 161
LmnI GCTCC 1 cut(s) 72
LpnPI CCDG 8 cut(s) 92, 110, 119, 157, 221, 230, 248, 250
MabI ACCWGGT 1 cut(s) 234
MaeII ACGT 1 cut(s) 146
MaeIII GTNAC 1 cut(s) 8
MboII GAAGA 1 cut(s) 294
MhlI GDGCHC 1 cut(s) 69
MluCI AATT 1 cut(s) 83
MnlI CCTC 1 cut(s) 21
MspR9I CCNGG 2 cut(s) 107, 236
Mva1269I GAATGC 1 cut(s) 167
MvaI CCWGG 2 cut(s) 107, 236
MwoI GCNNNNNNNGC 1 cut(s) 248
NcoI CCATGG 1 cut(s) 47
NlaIII CATG 3 cut(s) 51, 79, 161
NmuCI GTSAC 1 cut(s) 8
NspI RCATGY 1 cut(s) 79
PagI TCATGA 1 cut(s) 157
PciI ACATGT 1 cut(s) 75
PctI GAATGC 1 cut(s) 167
PfeI GAWTC 1 cut(s) 137
PscI ACATGT 1 cut(s) 75
PshAI GACNNNNGTC 1 cut(s) 122
Psp6I CCWGG 2 cut(s) 105, 234
PspGI CCWGG 2 cut(s) 105, 234
PspPI GGNCC 2 cut(s) 94, 124
Sau96I GGNCC 2 cut(s) 94, 124
ScrFI CCNGG 2 cut(s) 107, 236
SduI GDGCHC 1 cut(s) 69
SetI ASST 4 cut(s) 32, 149, 237, 311
SexAI ACCWGGT 1 cut(s) 234
SinI GGWCC 2 cut(s) 94, 124
Sse9I AATT 1 cut(s) 83
SsiI CCGC 2 cut(s) 40, 179
StyD4I CCNGG 2 cut(s) 105, 234
StyI CCWWGG 2 cut(s) 47, 90
TaiI ACGT 1 cut(s) 149
TasI AATT 1 cut(s) 83
TfiI GAWTC 1 cut(s) 137
TscAI CASTG 1 cut(s) 19
TseFI GTSAC 1 cut(s) 8
Tsp45I GTSAC 1 cut(s) 8
TspDTI ATGAA 1 cut(s) 116
TspGWI ACGGA 1 cut(s) 287
TspRI CASTG 1 cut(s) 19
VpaK11BI GGWCC 2 cut(s) 94, 124
XceI RCATGY 1 cut(s) 79
XmiI GTMKAC 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.