Rmu_ssc0000111.1_g000010

Glycine-rich RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000111.1
Physical Location & Seq
Reverse (-)
36412 .. 38186
1775 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000111.1_g000010.1.cds

Sequence Viewer

Length: 840 bp
atggctttcttgagtaaatttgggaatatacttcggcagtctgcaggcaagcagatcaactctgacttgtcttctttcaaactgtggacccatcaggctgtaagatgcatgtcatccatgggaggctcaaagctttttatcggaggtatttcgtatcagacggatgatggcagtctgagggaggcttttgcaagatatggagatgttgttgatgcacggatcatcacagaccgtgagagtggtagatcaagaggatttggatttgttacttacgctacacctgagggtgcatcaagtgccattcaggccttggatggaaaggatcttcatggccgtgtaataagggtgaattatgccaatgagaggcctcctcgtagtagctttggttatggaggaggtgatggtggttacgggggtggcggaggcagttacggtggtggcggaggtggttacggtggtgccggaggtggttacagtggtggtggaggcggttacggtggcagaggcggagggggctacaacagctatggcaatgacagttataatagtggtggtaattatggaagtggaaactcttttgaaactgctagtggtggaggttatggcaatagcacaaattttgctccttctggtagtgttgctactggtagtgccgataactttggagttggtggtggtgacagcagctttcccaccggtggaggttttggcgatagcccaaattatggttctcctggtagtgttggaactggtggtgctgataactttggtgttggtggcagtgatgacagtagctttcccaacagggacgatgagttaggctatcagagtagggcctga

Protein Analysis

279

Amino Acids

27.75

Weight (kDa)

5.16

Isoelectric Point (pI)

41.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 543
AccB1I GGYRCC 1 cut(s) 458
AccB7I CCANNNNNTGG 1 cut(s) 725
AciI CCGC 4 cut(s) 420, 441, 489, 507
AclWI GGATC 2 cut(s) 227, 330
AcoI YGGCCR 1 cut(s) 331
AcsI RAATTY 2 cut(s) 17, 616
AfiI CCNNNNNNNGG 3 cut(s) 363, 698, 725
AgeI ACCGGT 1 cut(s) 695
AgsI TTSAA 2 cut(s) 79, 581
AjnI CCWGG 1 cut(s) 733
AjuI GAANNNNNNNTTGG 2 cut(s) 712, 744
AluBI AGCT 5 cut(s) 133, 381, 525, 687, 795
AluI AGCT 5 cut(s) 133, 381, 525, 687, 795
AlwI GGATC 2 cut(s) 227, 330
AoxI GGCC 4 cut(s) 306, 331, 365, 834
ApeKI GCWGC 1 cut(s) 684
ApoI RAATTY 2 cut(s) 17, 616
AsiGI ACCGGT 1 cut(s) 695
AspS9I GGNCC 2 cut(s) 87, 834
AsuHPI GGTGA 3 cut(s) 358, 410, 689
AvaII GGWCC 1 cut(s) 87
AxyI CCTNAGG 1 cut(s) 282
BanI GGYRCC 1 cut(s) 458
BbsI GAAGAC 1 cut(s) 63
BbvI GCAGC 1 cut(s) 696
BccI CCATC 4 cut(s) 99, 161, 308, 395
BceAI ACGGC 1 cut(s) 318
BciT130I CCWGG 1 cut(s) 735
BfaI CTAG 1 cut(s) 588
BfmI CTRYAG 1 cut(s) 42
BglI GCCNNNNNGGC 1 cut(s) 305
BisI GCNGC 1 cut(s) 685
BlsI GCNGC 1 cut(s) 686
Bme1390I CCNGG 1 cut(s) 735
Bme18I GGWCC 1 cut(s) 87
BmgT120I GGNCC 2 cut(s) 87, 834
BmiI GGNNCC 2 cut(s) 89, 460
BmrFI CCNGG 1 cut(s) 735
BmsI GCATC 3 cut(s) 95, 202, 299
BpiI GAAGAC 1 cut(s) 63
BplI GAGNNNNNCTC 2 cut(s) 355, 387
BpuEI CTTGAG 1 cut(s) 31
BsaJI CCNNGG 2 cut(s) 117, 309
BsaWI WCCGGW 1 cut(s) 695
BsaXI ACNNNNNCTCC 2 cut(s) 192, 222
Bsc4I CCNNNNNNNGG 3 cut(s) 363, 698, 725
Bse118I RCCGGY 1 cut(s) 695
Bse1I ACTGG 2 cut(s) 649, 754
Bse21I CCTNAGG 1 cut(s) 282
Bse3DI GCAATG 1 cut(s) 538
BseBI CCWGG 1 cut(s) 735
BseDI CCNNGG 2 cut(s) 117, 309
BseGI GGATG 3 cut(s) 113, 169, 319
BseLI CCNNNNNNNGG 3 cut(s) 363, 698, 725
BseMI GCAATG 1 cut(s) 538
BseMII CTCAG 2 cut(s) 167, 273
BseNI ACTGG 2 cut(s) 649, 754
BseRI GAGGAG 2 cut(s) 360, 408
BseXI GCAGC 1 cut(s) 696
BshFI GGCC 4 cut(s) 308, 333, 367, 836
BshNI GGYRCC 1 cut(s) 458
BshTI ACCGGT 1 cut(s) 695
BsiSI CCGG 2 cut(s) 462, 696
BslFI GGGAC 1 cut(s) 821
BslI CCNNNNNNNGG 3 cut(s) 363, 698, 725
BsmFI GGGAC 1 cut(s) 821
BsnI GGCC 4 cut(s) 308, 333, 367, 836
Bsp143I GATC 4 cut(s) 54, 219, 245, 322
Bsp19I CCATGG 1 cut(s) 117
BspACI CCGC 4 cut(s) 420, 441, 489, 507
BspANI GGCC 4 cut(s) 308, 333, 367, 836
BspCNI CTCAG 2 cut(s) 168, 274
BspLI GGNNCC 2 cut(s) 89, 460
BspMAI CTGCAG 1 cut(s) 46
BspPI GGATC 2 cut(s) 227, 330
BspT107I GGYRCC 1 cut(s) 458
BsrDI GCAATG 1 cut(s) 538
BsrFI RCCGGY 1 cut(s) 695
BsrI ACTGG 2 cut(s) 649, 754
BssAI RCCGGY 1 cut(s) 695
BssECI CCNNGG 2 cut(s) 117, 309
BssMI GATC 4 cut(s) 54, 219, 245, 322
BssT1I CCWWGG 2 cut(s) 117, 309
Bst2UI CCWGG 1 cut(s) 735
Bst4CI ACNGT 8 cut(s) 84, 233, 434, 455, 476, 497, 539, 791
BstAPI GCANNNNNTGC 1 cut(s) 296
BstC8I GCNNGC 2 cut(s) 46, 50
BstDEI CTNAG 2 cut(s) 176, 282
BstDSI CCRYGG 1 cut(s) 117
BstF5I GGATG 3 cut(s) 113, 169, 319
BstKTI GATC 4 cut(s) 57, 222, 248, 325
BstMBI GATC 4 cut(s) 54, 219, 245, 322
BstMWI GCNNNNNNNGC 4 cut(s) 296, 305, 513, 522
BstNI CCWGG 1 cut(s) 735
BstNSI RCATGY 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 733
BstSFI CTRYAG 1 cut(s) 42
BstV1I GCAGC 1 cut(s) 696
BstV2I GAAGAC 1 cut(s) 63
BstX2I RGATCY 1 cut(s) 322
BstYI RGATCY 1 cut(s) 322
Bsu36I CCTNAGG 1 cut(s) 282
BsuRI GGCC 4 cut(s) 308, 333, 367, 836
BtgI CCRYGG 1 cut(s) 117
BtsCI GGATG 3 cut(s) 113, 169, 319
BtsI GCAGTG 1 cut(s) 787
BtsIMutI CAGTG 2 cut(s) 481, 787
Cac8I GCNNGC 2 cut(s) 46, 50
Cfr10I RCCGGY 1 cut(s) 695
Cfr13I GGNCC 2 cut(s) 87, 834
CspAI ACCGGT 1 cut(s) 695
CviAII CATG 3 cut(s) 109, 118, 329
DdeI CTNAG 2 cut(s) 176, 282
DpnI GATC 4 cut(s) 56, 221, 247, 324
DpnII GATC 4 cut(s) 54, 219, 245, 322
EaeI YGGCCR 1 cut(s) 331
EciI GGCGGA 3 cut(s) 435, 456, 522
Eco130I CCWWGG 2 cut(s) 117, 309
Eco147I AGGCCT 2 cut(s) 308, 367
Eco47I GGWCC 1 cut(s) 87
Eco81I CCTNAGG 1 cut(s) 282
EcoO109I RGGNCCY 1 cut(s) 834
EcoRII CCWGG 1 cut(s) 733
EcoT14I CCWWGG 2 cut(s) 117, 309
EcoT22I ATGCAT 1 cut(s) 110
ErhI CCWWGG 2 cut(s) 117, 309
FaeI CATG 3 cut(s) 112, 121, 332
FaqI GGGAC 1 cut(s) 821
FatI CATG 3 cut(s) 108, 117, 328
Fnu4HI GCNGC 1 cut(s) 685
FokI GGATG 3 cut(s) 100, 176, 326
Fsp4HI GCNGC 1 cut(s) 685
FspBI CTAG 1 cut(s) 588
GluI GCNGC 1 cut(s) 685
HaeIII GGCC 4 cut(s) 308, 333, 367, 836
HapII CCGG 2 cut(s) 462, 696
Hin1II CATG 3 cut(s) 112, 121, 332
HindIII AAGCTT 1 cut(s) 131
HpaII CCGG 2 cut(s) 462, 696
HphI GGTGA 3 cut(s) 358, 410, 689
Hpy166II GTNNAC 1 cut(s) 87
Hpy188I TCNGA 5 cut(s) 64, 143, 159, 177, 828
Hpy188III TCNNGA 2 cut(s) 10, 249
Hpy8I GTNNAC 1 cut(s) 87
HpyAV CCTTC 1 cut(s) 636
HpyCH4III ACNGT 8 cut(s) 84, 233, 434, 455, 476, 497, 539, 791
HpyCH4V TGCA 5 cut(s) 44, 108, 191, 215, 290
HpyF10VI GCNNNNNNNGC 4 cut(s) 296, 305, 513, 522
HpyF3I CTNAG 2 cut(s) 176, 282
Hsp92II CATG 3 cut(s) 112, 121, 332
Kzo9I GATC 4 cut(s) 54, 219, 245, 322
LmnI GCTCC 1 cut(s) 628
Lsp1109I GCAGC 1 cut(s) 696
LweI GCATC 3 cut(s) 95, 202, 299
MaeI CTAG 1 cut(s) 588
MaeIII GTNAC 7 cut(s) 265, 407, 428, 449, 470, 491, 677
MalI GATC 4 cut(s) 56, 221, 247, 324
MboI GATC 4 cut(s) 54, 219, 245, 322
MboII GAAGA 2 cut(s) 63, 317
MflI RGATCY 1 cut(s) 322
MluCI AATT 5 cut(s) 17, 349, 556, 616, 721
MmeI TCCRAC 1 cut(s) 724
Mph1103I ATGCAT 1 cut(s) 110
MslI CAYNNNNRTG 1 cut(s) 333
MspI CCGG 2 cut(s) 462, 696
MspR9I CCNGG 1 cut(s) 735
MvaI CCWGG 1 cut(s) 735
MwoI GCNNNNNNNGC 4 cut(s) 296, 305, 513, 522
NcoI CCATGG 1 cut(s) 117
NdeII GATC 4 cut(s) 54, 219, 245, 322
NlaIII CATG 3 cut(s) 112, 121, 332
NlaIV GGNNCC 2 cut(s) 89, 460
NmuCI GTSAC 1 cut(s) 677
NsiI ATGCAT 1 cut(s) 110
NspI RCATGY 1 cut(s) 112
PceI AGGCCT 2 cut(s) 308, 367
PflMI CCANNNNNTGG 1 cut(s) 725
PinAI ACCGGT 1 cut(s) 695
PkrI GCNGC 1 cut(s) 686
PsiI TTATAA 1 cut(s) 543
Psp6I CCWGG 1 cut(s) 733
PspGI CCWGG 1 cut(s) 733
PspN4I GGNNCC 2 cut(s) 89, 460
PspPI GGNCC 2 cut(s) 87, 834
PstI CTGCAG 1 cut(s) 46
PsuI RGATCY 1 cut(s) 322
RseI CAYNNNNRTG 1 cut(s) 333
SatI GCNGC 1 cut(s) 685
Sau3AI GATC 4 cut(s) 54, 219, 245, 322
Sau96I GGNCC 2 cut(s) 87, 834
ScrFI CCNGG 1 cut(s) 735
SfaNI GCATC 3 cut(s) 95, 202, 299
SfcI CTRYAG 1 cut(s) 42
SgrAI CRCCGGYG 1 cut(s) 695
SinI GGWCC 1 cut(s) 87
SmiMI CAYNNNNRTG 1 cut(s) 333
SmlI CTYRAG 1 cut(s) 10
SmoI CTYRAG 1 cut(s) 10
Sse9I AATT 5 cut(s) 17, 349, 556, 616, 721
SseBI AGGCCT 2 cut(s) 308, 367
SsiI CCGC 4 cut(s) 420, 441, 489, 507
SspMI CTAG 1 cut(s) 588
StuI AGGCCT 2 cut(s) 308, 367
StyD4I CCNGG 1 cut(s) 733
StyI CCWWGG 2 cut(s) 117, 309
TaaI ACNGT 8 cut(s) 84, 233, 434, 455, 476, 497, 539, 791
TasI AATT 5 cut(s) 17, 349, 556, 616, 721
TscAI CASTG 2 cut(s) 481, 787
TseFI GTSAC 1 cut(s) 677
TseI GCWGC 1 cut(s) 684
Tsp45I GTSAC 1 cut(s) 677
TspDTI ATGAA 1 cut(s) 317
TspGWI ACGGA 2 cut(s) 176, 232
TspRI CASTG 2 cut(s) 481, 787
Van91I CCANNNNNTGG 1 cut(s) 725
VpaK11BI GGWCC 1 cut(s) 87
XapI RAATTY 2 cut(s) 17, 616
XceI RCATGY 1 cut(s) 112
XcmI CCANNNNNNNNNTGG 1 cut(s) 307
XspI CTAG 1 cut(s) 588
Zsp2I ATGCAT 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.