Rh7CG057100

Glycine-rich RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
4167791 .. 4168147
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG057100.1

Sequence Viewer

Length: 273 bp
ATGGCTTTCTTGAGTAAATTTGGGAATATACTTCGGCAGTCTGCAGGCAAGCAGATCAACTCTGACTTGTCTTCTTTCAAACTGTGGACCCATCAGGCTGTAAGATGCATGTCATCCATGGGAAGCTCAAAGCTTTTTATCGGAGGTATTTCGTATCAGACGGATGATGGCAGTCTGAGGGAGGCTTTTGCAAGATATGGAGATGTTGTTGATGGTATGTGGAAATCTGTAATCTGTATTCTAGAAAAAAAGTATACATTGCAGTTATTGTAG

Protein Analysis

90

Amino Acids

10.08

Weight (kDa)

9.3

Isoelectric Point (pI)

44.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 254
AcsI RAATTY 1 cut(s) 17
AgsI TTSAA 1 cut(s) 79
AluBI AGCT 2 cut(s) 126, 133
AluI AGCT 2 cut(s) 126, 133
ApoI RAATTY 1 cut(s) 17
AspS9I GGNCC 1 cut(s) 87
AvaII GGWCC 1 cut(s) 87
BbsI GAAGAC 1 cut(s) 63
BccI CCATC 3 cut(s) 99, 161, 206
BfaI CTAG 1 cut(s) 242
BfmI CTRYAG 1 cut(s) 42
Bme18I GGWCC 1 cut(s) 87
BmgT120I GGNCC 1 cut(s) 87
BmiI GGNNCC 1 cut(s) 89
BmsI GCATC 1 cut(s) 95
BpiI GAAGAC 1 cut(s) 63
BpuEI CTTGAG 1 cut(s) 31
BsaJI CCNNGG 1 cut(s) 117
BsaXI ACNNNNNCTCC 2 cut(s) 192, 222
Bse3DI GCAATG 1 cut(s) 257
BseDI CCNNGG 1 cut(s) 117
BseGI GGATG 2 cut(s) 113, 169
BseMI GCAATG 1 cut(s) 257
BseMII CTCAG 1 cut(s) 167
Bsp143I GATC 1 cut(s) 54
Bsp19I CCATGG 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 168
BspLI GGNNCC 1 cut(s) 89
BspMAI CTGCAG 1 cut(s) 46
BsrDI GCAATG 1 cut(s) 257
BssECI CCNNGG 1 cut(s) 117
BssMI GATC 1 cut(s) 54
BssNAI GTATAC 1 cut(s) 255
BssT1I CCWWGG 1 cut(s) 117
Bst1107I GTATAC 1 cut(s) 255
Bst4CI ACNGT 1 cut(s) 84
BstC8I GCNNGC 2 cut(s) 46, 50
BstDEI CTNAG 1 cut(s) 176
BstDSI CCRYGG 1 cut(s) 117
BstF5I GGATG 2 cut(s) 113, 169
BstKTI GATC 1 cut(s) 57
BstMBI GATC 1 cut(s) 54
BstNSI RCATGY 1 cut(s) 112
BstSFI CTRYAG 1 cut(s) 42
BstV2I GAAGAC 1 cut(s) 63
BstZ17I GTATAC 1 cut(s) 255
BtgI CCRYGG 1 cut(s) 117
BtsCI GGATG 2 cut(s) 113, 169
Cac8I GCNNGC 2 cut(s) 46, 50
Cfr13I GGNCC 1 cut(s) 87
CviAII CATG 2 cut(s) 109, 118
CviJI RGCY 5 cut(s) 5, 98, 126, 133, 185
CviKI_1 RGCY 5 cut(s) 5, 98, 126, 133, 185
DdeI CTNAG 1 cut(s) 176
DpnI GATC 1 cut(s) 56
DpnII GATC 1 cut(s) 54
Eco130I CCWWGG 1 cut(s) 117
Eco47I GGWCC 1 cut(s) 87
EcoT14I CCWWGG 1 cut(s) 117
EcoT22I ATGCAT 1 cut(s) 110
ErhI CCWWGG 1 cut(s) 117
FaeI CATG 2 cut(s) 112, 121
FaiI YATR 6 cut(s) 29, 110, 119, 198, 218, 255
FatI CATG 2 cut(s) 108, 117
FblI GTMKAC 1 cut(s) 254
FokI GGATG 2 cut(s) 100, 176
FspBI CTAG 1 cut(s) 242
Hin1II CATG 2 cut(s) 112, 121
HindIII AAGCTT 1 cut(s) 131
Hpy166II GTNNAC 2 cut(s) 87, 255
Hpy188I TCNGA 4 cut(s) 64, 143, 159, 177
Hpy188III TCNNGA 2 cut(s) 10, 242
Hpy8I GTNNAC 2 cut(s) 87, 255
HpyCH4III ACNGT 1 cut(s) 84
HpyCH4V TGCA 4 cut(s) 44, 108, 191, 262
HpyF3I CTNAG 1 cut(s) 176
Hsp92II CATG 2 cut(s) 112, 121
Kzo9I GATC 1 cut(s) 54
LpnPI CCDG 2 cut(s) 30, 80
LweI GCATC 1 cut(s) 95
MaeI CTAG 1 cut(s) 242
MalI GATC 1 cut(s) 56
MboI GATC 1 cut(s) 54
MboII GAAGA 1 cut(s) 63
MluCI AATT 1 cut(s) 17
MnlI CCTC 3 cut(s) 137, 171, 175
Mph1103I ATGCAT 1 cut(s) 110
NcoI CCATGG 1 cut(s) 117
NdeII GATC 1 cut(s) 54
NlaIII CATG 2 cut(s) 112, 121
NlaIV GGNNCC 1 cut(s) 89
NsiI ATGCAT 1 cut(s) 110
NspI RCATGY 1 cut(s) 112
PspN4I GGNNCC 1 cut(s) 89
PspPI GGNCC 1 cut(s) 87
PstI CTGCAG 1 cut(s) 46
Sau3AI GATC 1 cut(s) 54
Sau96I GGNCC 1 cut(s) 87
SetI ASST 3 cut(s) 128, 135, 148
SfaNI GCATC 1 cut(s) 95
SfcI CTRYAG 1 cut(s) 42
SgeI CNNG 9 cut(s) 22, 57, 61, 79, 107, 121, 130, 204, 254
SinI GGWCC 1 cut(s) 87
SmlI CTYRAG 1 cut(s) 10
SmoI CTYRAG 1 cut(s) 10
Sse9I AATT 1 cut(s) 17
SspMI CTAG 1 cut(s) 242
StyI CCWWGG 1 cut(s) 117
TaaI ACNGT 1 cut(s) 84
TasI AATT 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 176
VpaK11BI GGWCC 1 cut(s) 87
XapI RAATTY 1 cut(s) 17
XbaI TCTAGA 1 cut(s) 241
XceI RCATGY 1 cut(s) 112
XmiI GTMKAC 1 cut(s) 254
XspI CTAG 1 cut(s) 242
Zsp2I ATGCAT 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.