Rroxscaffold_1G00005490

oligopeptide transporter

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
7477869 .. 7478446
578 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00005490.1

Sequence Viewer

Length: 216 bp
ATGGAAAAGGCTCTCTACAAAATGCTGCTTGCCAACCATCTTAATTGGTGGCTTCTCACAGATGTCGAAAACATCTGTGATGTATCAAAGTTTCCAAAGCGAAGTCCATGGACAAGTCCCGGTGATAATGTGCTCTACAATGCCTCAATCACATGGGGAGACATAGGTCCACTCAGAATGCTCACCAATAAAGGCATCTACCCGGAGGTGAACTAG

Protein Analysis

71

Amino Acids

8.18

Weight (kDa)

6.53

Isoelectric Point (pI)

49.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw21I GWGCWC 1 cut(s) 135
Alw26I GTCTC 1 cut(s) 153
ApeKI GCWGC 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 167
AsuC2I CCSGG 2 cut(s) 120, 203
AsuHPI GGTGA 2 cut(s) 134, 175
AvaII GGWCC 1 cut(s) 167
Bbv12I GWGCWC 1 cut(s) 135
BbvI GCAGC 1 cut(s) 12
BccI CCATC 1 cut(s) 45
BcnI CCSGG 2 cut(s) 120, 203
BcoDI GTCTC 1 cut(s) 153
BfaI CTAG 1 cut(s) 214
BisI GCNGC 1 cut(s) 26
BlsI GCNGC 1 cut(s) 27
Bme1390I CCNGG 2 cut(s) 120, 203
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BmrFI CCNGG 2 cut(s) 120, 203
BmsI GCATC 1 cut(s) 204
BoxI GACNNNNGTC 1 cut(s) 165
BpuMI CCSGG 2 cut(s) 120, 203
BsaJI CCNNGG 1 cut(s) 107
BseDI CCNNGG 1 cut(s) 107
BseMII CTCAG 1 cut(s) 187
BseXI GCAGC 1 cut(s) 12
BsiHKAI GWGCWC 1 cut(s) 135
BsiSI CCGG 2 cut(s) 120, 203
BslFI GGGAC 1 cut(s) 102
BsmAI GTCTC 1 cut(s) 153
BsmFI GGGAC 1 cut(s) 102
BsmI GAATGC 1 cut(s) 183
Bsp1286I GDGCHC 1 cut(s) 135
Bsp19I CCATGG 1 cut(s) 107
BspCNI CTCAG 1 cut(s) 186
BssECI CCNNGG 1 cut(s) 107
BssT1I CCWWGG 1 cut(s) 107
BstC8I GCNNGC 1 cut(s) 30
BstDEI CTNAG 1 cut(s) 173
BstDSI CCRYGG 1 cut(s) 107
BstMAI GTCTC 1 cut(s) 153
BstPAI GACNNNNGTC 1 cut(s) 165
BstSCI CCNGG 2 cut(s) 118, 201
BstV1I GCAGC 1 cut(s) 12
BtgI CCRYGG 1 cut(s) 107
Cac8I GCNNGC 1 cut(s) 30
Cfr13I GGNCC 1 cut(s) 167
CviAII CATG 2 cut(s) 108, 153
CviJI RGCY 2 cut(s) 11, 52
CviKI_1 RGCY 2 cut(s) 11, 52
DdeI CTNAG 1 cut(s) 173
Eco130I CCWWGG 1 cut(s) 107
Eco47I GGWCC 1 cut(s) 167
EcoT14I CCWWGG 1 cut(s) 107
ErhI CCWWGG 1 cut(s) 107
FaeI CATG 2 cut(s) 111, 156
FaiI YATR 3 cut(s) 109, 154, 164
FaqI GGGAC 1 cut(s) 102
FatI CATG 2 cut(s) 107, 152
Fnu4HI GCNGC 1 cut(s) 26
Fsp4HI GCNGC 1 cut(s) 26
FspBI CTAG 1 cut(s) 214
GluI GCNGC 1 cut(s) 26
HapII CCGG 2 cut(s) 120, 203
Hin1II CATG 2 cut(s) 111, 156
HpaII CCGG 2 cut(s) 120, 203
HphI GGTGA 2 cut(s) 134, 175
Hpy166II GTNNAC 2 cut(s) 170, 211
Hpy188I TCNGA 1 cut(s) 176
Hpy8I GTNNAC 2 cut(s) 170, 211
HpyF3I CTNAG 1 cut(s) 173
Hsp92II CATG 2 cut(s) 111, 156
LpnPI CCDG 1 cut(s) 133
Lsp1109I GCAGC 1 cut(s) 12
LweI GCATC 1 cut(s) 204
MaeI CTAG 1 cut(s) 214
MhlI GDGCHC 1 cut(s) 135
MluCI AATT 1 cut(s) 43
MnlI CCTC 2 cut(s) 154, 199
MseI TTAA 1 cut(s) 42
MspI CCGG 2 cut(s) 120, 203
MspR9I CCNGG 2 cut(s) 120, 203
Mva1269I GAATGC 1 cut(s) 183
NciI CCSGG 2 cut(s) 120, 203
NcoI CCATGG 1 cut(s) 107
NlaIII CATG 2 cut(s) 111, 156
PctI GAATGC 1 cut(s) 183
PkrI GCNGC 1 cut(s) 27
PshAI GACNNNNGTC 1 cut(s) 165
PspPI GGNCC 1 cut(s) 167
SaqAI TTAA 1 cut(s) 42
SatI GCNGC 1 cut(s) 26
Sau96I GGNCC 1 cut(s) 167
ScrFI CCNGG 2 cut(s) 120, 203
SduI GDGCHC 1 cut(s) 135
SetI ASST 2 cut(s) 169, 210
SfaNI GCATC 1 cut(s) 204
SgeI CNNG 6 cut(s) 41, 120, 126, 131, 132, 165
SinI GGWCC 1 cut(s) 167
Sse9I AATT 1 cut(s) 43
SspMI CTAG 1 cut(s) 214
StyD4I CCNGG 2 cut(s) 118, 201
StyI CCWWGG 1 cut(s) 107
TaqI TCGA 1 cut(s) 66
TasI AATT 1 cut(s) 43
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TseI GCWGC 1 cut(s) 25
VpaK11BI GGWCC 1 cut(s) 167
XspI CTAG 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.