Rroxscaffold_5G00344250

Belongs to the peptidase A1 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
14243401 .. 14248231
4831 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00344250.1

Sequence Viewer

Length: 210 bp
ATGAGGAAGGTTCGGGAGAATATTTTTGGGGACCAGGGACCAAATACTCGACGGTCTACATCCTTCTTGCCCTCAAACGGAAACTATGAAACCTACTTTGTTGGTGTGGAAGTATGTTGTATTGCGGATCATGGTGGACATGGATCATGGTGGACATGGGGCATTTCCCAACGAGATTCTTATTTTATTTTTAGACTTTCTGTTCGGTAG

Protein Analysis

69

Amino Acids

7.99

Weight (kDa)

8.8

Isoelectric Point (pI)

23.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 56
AciI CCGC 1 cut(s) 125
AclWI GGATC 2 cut(s) 135, 151
AfiI CCNNNNNNNGG 1 cut(s) 77
AjnI CCWGG 1 cut(s) 33
AlwI GGATC 2 cut(s) 135, 151
ArsI GACNNNNNNTTYG 1 cut(s) 186
AspS9I GGNCC 2 cut(s) 31, 38
AvaII GGWCC 2 cut(s) 31, 38
BciT130I CCWGG 1 cut(s) 35
Bme1390I CCNGG 1 cut(s) 35
Bme18I GGWCC 2 cut(s) 31, 38
BmgT120I GGNCC 2 cut(s) 31, 38
BmiI GGNNCC 2 cut(s) 32, 39
BmrFI CCNGG 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 34
Bsc4I CCNNNNNNNGG 1 cut(s) 77
BseBI CCWGG 1 cut(s) 35
BseDI CCNNGG 1 cut(s) 34
BseGI GGATG 1 cut(s) 59
BseLI CCNNNNNNNGG 1 cut(s) 77
BslFI GGGAC 2 cut(s) 44, 51
BslI CCNNNNNNNGG 1 cut(s) 77
BsmFI GGGAC 2 cut(s) 44, 51
Bsp143I GATC 2 cut(s) 127, 143
BspACI CCGC 1 cut(s) 125
BspLI GGNNCC 2 cut(s) 32, 39
BspPI GGATC 2 cut(s) 135, 151
BssECI CCNNGG 1 cut(s) 34
BssMI GATC 2 cut(s) 127, 143
Bst2UI CCWGG 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 54
BstF5I GGATG 1 cut(s) 59
BstKTI GATC 2 cut(s) 130, 146
BstMBI GATC 2 cut(s) 127, 143
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
BtsCI GGATG 1 cut(s) 59
Cfr13I GGNCC 2 cut(s) 31, 38
CviAII CATG 4 cut(s) 131, 140, 147, 156
DpnI GATC 2 cut(s) 129, 145
DpnII GATC 2 cut(s) 127, 143
Eco47I GGWCC 2 cut(s) 31, 38
EcoRII CCWGG 1 cut(s) 33
FaeI CATG 4 cut(s) 134, 143, 150, 159
FaiI YATR 6 cut(s) 87, 115, 132, 141, 148, 157
FaqI GGGAC 2 cut(s) 44, 51
FatI CATG 4 cut(s) 130, 139, 146, 155
FblI GTMKAC 1 cut(s) 56
FokI GGATG 1 cut(s) 46
Hin1II CATG 4 cut(s) 134, 143, 150, 159
HinfI GANTC 1 cut(s) 176
Hpy166II GTNNAC 3 cut(s) 57, 137, 153
Hpy188III TCNNGA 1 cut(s) 14
Hpy8I GTNNAC 3 cut(s) 57, 137, 153
Hpy99I CGWCG 1 cut(s) 54
HpyAV CCTTC 1 cut(s) 73
HpyCH4III ACNGT 1 cut(s) 54
Hsp92II CATG 4 cut(s) 134, 143, 150, 159
Kzo9I GATC 2 cut(s) 127, 143
LpnPI CCDG 2 cut(s) 20, 47
MalI GATC 2 cut(s) 129, 145
MboI GATC 2 cut(s) 127, 143
MnlI CCTC 1 cut(s) 82
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
NdeII GATC 2 cut(s) 127, 143
NlaIII CATG 4 cut(s) 134, 143, 150, 159
NlaIV GGNNCC 2 cut(s) 32, 39
PfeI GAWTC 1 cut(s) 176
Psp6I CCWGG 1 cut(s) 33
PspGI CCWGG 1 cut(s) 33
PspN4I GGNNCC 2 cut(s) 32, 39
PspPI GGNCC 2 cut(s) 31, 38
Sau3AI GATC 2 cut(s) 127, 143
Sau96I GGNCC 2 cut(s) 31, 38
ScrFI CCNGG 1 cut(s) 35
SetI ASST 2 cut(s) 12, 95
SinI GGWCC 2 cut(s) 31, 38
SsiI CCGC 1 cut(s) 125
SspI AATATT 1 cut(s) 22
StyD4I CCNGG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 54
TaqI TCGA 1 cut(s) 49
TfiI GAWTC 1 cut(s) 176
TspDTI ATGAA 1 cut(s) 102
TspGWI ACGGA 1 cut(s) 93
VpaK11BI GGWCC 2 cut(s) 31, 38
XmiI GTMKAC 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.