Rorug06G0405000

ABC transporter I family member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0001882
Physical Location & Seq
Reverse (-)
54871977 .. 54874427
2451 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0405000.1

Sequence Viewer

Length: 687 bp
ATGACGGTGTTTCACTTCTTCAACTGTGCGATTCTGACGTTTGGTCCTCACGCCGTATACTACTCCGCCACTCCTCTATCGGAGTATGACACACTCGGCACCTCCATTAAAGCAGCTGTGGTTTATCTCGGAACAGCTCTAGTCAAGCTTGTTTGTTTGGCTACTTTTCTCAAGGTATCTGATAATGAAAGCTTCGATCCATATCAGGAATTGTTGAAAGCTTTGATCGGTTTCATAGATGTTGCTGGCCTTTACTTTGCTTTGACCCAGTTGACCCATAGGAACATCTCTCAAAATCATAAATTTCAAGCAGTGGGACTCGGGTGGGCTTTTGCTGATTCGGTTCTCCATAGATTGGCACCTCTGTGGGTGGGTGCCAGAGGACTAGAATTTACCTGGGATTACATTCTGCAAGGCCTTGAGGCAAATGCAAATCTGGTTTTGAGCATATCCCTTGCTGCATTGGGATCTTTGATGTGGCTTCGCAAAAACAAGCCTAAGACGCTGATTCCTATAATATACATCTGTGCTGGGATTGTGGCAACCATGCCATCTATCACAAGCTATCTAAGGCGTGGCCTGGGGTGGCACTTCCCGGAGGTGGTAGGATTTCAACTCTTTACCTCTCTGATCATGGCATTCATCAGCTGGCAGCTCTTTGCTGCATGTCAGAGGCCCTCTGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03018 map03018
Pfam Domains
Protein Families
ABC_tran

Protein Analysis

228

Amino Acids

25.27

Weight (kDa)

8.67

Isoelectric Point (pI)

31.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF2053 PF09767 2 - 161 1.2e-59 Predicted membrane protein (DUF2053)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 3 cut(s) 98, 358, 374
AccB7I CCANNNNNTGG 1 cut(s) 355
AccI GTMKAC 1 cut(s) 57
AciI CCGC 1 cut(s) 66
AclWI GGATC 2 cut(s) 191, 475
AcsI RAATTY 2 cut(s) 302, 389
AfiI CCNNNNNNNGG 2 cut(s) 355, 601
AgsI TTSAA 4 cut(s) 22, 217, 308, 614
AhdI GACNNNNNGTC 1 cut(s) 42
AjnI CCWGG 2 cut(s) 395, 579
AleI CACNNNNGTG 1 cut(s) 364
AluBI AGCT 8 cut(s) 116, 137, 148, 192, 221, 564, 648, 655
AluI AGCT 8 cut(s) 116, 137, 148, 192, 221, 564, 648, 655
AlwI GGATC 2 cut(s) 191, 475
Ama87I CYCGRG 1 cut(s) 320
AoxI GGCC 4 cut(s) 247, 415, 577, 674
ApeKI GCWGC 4 cut(s) 113, 458, 652, 662
ApoI RAATTY 2 cut(s) 302, 389
AspS9I GGNCC 2 cut(s) 44, 675
AsuC2I CCSGG 1 cut(s) 596
AvaI CYCGRG 1 cut(s) 320
AvaII GGWCC 1 cut(s) 44
BanI GGYRCC 3 cut(s) 98, 358, 374
BbvI GCAGC 4 cut(s) 125, 445, 649, 664
BccI CCATC 1 cut(s) 559
BceAI ACGGC 1 cut(s) 38
BciT130I CCWGG 2 cut(s) 397, 581
BclI TGATCA 1 cut(s) 630
BcnI CCSGG 1 cut(s) 596
BfaI CTAG 2 cut(s) 140, 386
BisI GCNGC 4 cut(s) 114, 459, 653, 663
BlsI GCNGC 4 cut(s) 115, 460, 654, 664
Bme1390I CCNGG 3 cut(s) 397, 581, 596
Bme18I GGWCC 1 cut(s) 44
BmeRI GACNNNNNGTC 1 cut(s) 42
BmeT110I CYCGRG 1 cut(s) 320
BmgT120I GGNCC 2 cut(s) 44, 675
BmiI GGNNCC 3 cut(s) 100, 360, 376
BmrFI CCNGG 3 cut(s) 397, 581, 596
BmrI ACTGGG 1 cut(s) 262
BmuI ACTGGG 1 cut(s) 262
BpuEI CTTGAG 2 cut(s) 155, 440
BpuMI CCSGG 1 cut(s) 596
BsaBI GATNNNNATC 1 cut(s) 201
BsaJI CCNNGG 2 cut(s) 396, 580
Bsc4I CCNNNNNNNGG 2 cut(s) 355, 601
Bse1I ACTGG 1 cut(s) 268
Bse8I GATNNNNATC 1 cut(s) 201
BseBI CCWGG 2 cut(s) 397, 581
BseDI CCNNGG 2 cut(s) 396, 580
BseJI GATNNNNATC 1 cut(s) 201
BseLI CCNNNNNNNGG 2 cut(s) 355, 601
BseNI ACTGG 1 cut(s) 268
BseRI GAGGAG 1 cut(s) 63
BseXI GCAGC 4 cut(s) 125, 445, 649, 664
BseYI CCCAGC 1 cut(s) 530
BshFI GGCC 4 cut(s) 249, 417, 579, 676
BshNI GGYRCC 3 cut(s) 98, 358, 374
BsiHKCI CYCGRG 1 cut(s) 320
BsiSI CCGG 1 cut(s) 596
BslFI GGGAC 1 cut(s) 330
BslI CCNNNNNNNGG 2 cut(s) 355, 601
BsmFI GGGAC 1 cut(s) 330
BsmI GAATGC 1 cut(s) 638
BsnI GGCC 4 cut(s) 249, 417, 579, 676
BsoBI CYCGRG 1 cut(s) 320
Bsp143I GATC 4 cut(s) 196, 225, 467, 630
BspACI CCGC 1 cut(s) 66
BspANI GGCC 4 cut(s) 249, 417, 579, 676
BspLI GGNNCC 3 cut(s) 100, 360, 376
BspPI GGATC 2 cut(s) 191, 475
BspT107I GGYRCC 3 cut(s) 98, 358, 374
BsrI ACTGG 1 cut(s) 268
BssECI CCNNGG 2 cut(s) 396, 580
BssMI GATC 4 cut(s) 196, 225, 467, 630
BssNAI GTATAC 1 cut(s) 58
Bst1107I GTATAC 1 cut(s) 58
Bst2UI CCWGG 2 cut(s) 397, 581
Bst4CI ACNGT 2 cut(s) 7, 26
BstC8I GCNNGC 2 cut(s) 247, 650
BstDEI CTNAG 2 cut(s) 498, 569
BstKTI GATC 4 cut(s) 199, 228, 470, 633
BstMBI GATC 4 cut(s) 196, 225, 467, 630
BstMWI GCNNNNNNNGC 1 cut(s) 502
BstNI CCWGG 2 cut(s) 397, 581
BstNSI RCATGY 1 cut(s) 669
BstSCI CCNGG 3 cut(s) 395, 579, 594
BstV1I GCAGC 4 cut(s) 125, 445, 649, 664
BstX2I RGATCY 1 cut(s) 467
BstYI RGATCY 1 cut(s) 467
BstZ17I GTATAC 1 cut(s) 58
BsuRI GGCC 4 cut(s) 249, 417, 579, 676
BtsI GCAGTG 1 cut(s) 318
BtsIMutI CAGTG 1 cut(s) 318
Cac8I GCNNGC 2 cut(s) 247, 650
Cfr13I GGNCC 2 cut(s) 44, 675
CseI GACGC 1 cut(s) 511
CviAII CATG 3 cut(s) 547, 634, 666
DdeI CTNAG 2 cut(s) 498, 569
DpnI GATC 4 cut(s) 198, 227, 469, 632
DpnII GATC 4 cut(s) 196, 225, 467, 630
DriI GACNNNNNGTC 1 cut(s) 42
Eam1105I GACNNNNNGTC 1 cut(s) 42
EciI GGCGGA 1 cut(s) 55
Eco147I AGGCCT 1 cut(s) 417
Eco47I GGWCC 1 cut(s) 44
Eco88I CYCGRG 1 cut(s) 320
EcoO109I RGGNCCY 1 cut(s) 675
EcoRII CCWGG 2 cut(s) 395, 579
FaeI CATG 3 cut(s) 550, 637, 669
FaqI GGGAC 1 cut(s) 330
FatI CATG 3 cut(s) 546, 633, 665
FbaI TGATCA 1 cut(s) 630
FblI GTMKAC 1 cut(s) 57
Fnu4HI GCNGC 4 cut(s) 114, 459, 653, 663
Fsp4HI GCNGC 4 cut(s) 114, 459, 653, 663
FspBI CTAG 2 cut(s) 140, 386
GluI GCNGC 4 cut(s) 114, 459, 653, 663
GsaI CCCAGC 1 cut(s) 534
HaeIII GGCC 4 cut(s) 249, 417, 579, 676
HapII CCGG 1 cut(s) 596
HgaI GACGC 1 cut(s) 511
Hin1II CATG 3 cut(s) 550, 637, 669
HincII GTYRAC 1 cut(s) 273
HindII GTYRAC 1 cut(s) 273
HindIII AAGCTT 3 cut(s) 146, 190, 219
HinfI GANTC 4 cut(s) 31, 318, 338, 508
HpaII CCGG 1 cut(s) 596
Hpy166II GTNNAC 2 cut(s) 58, 273
Hpy188I TCNGA 6 cut(s) 36, 82, 131, 181, 630, 672
Hpy188III TCNNGA 1 cut(s) 206
Hpy8I GTNNAC 2 cut(s) 58, 273
HpyCH4III ACNGT 2 cut(s) 7, 26
HpyCH4IV ACGT 1 cut(s) 38
HpyCH4V TGCA 4 cut(s) 412, 431, 461, 665
HpyF10VI GCNNNNNNNGC 1 cut(s) 502
HpyF3I CTNAG 2 cut(s) 498, 569
HpySE526I ACGT 1 cut(s) 38
Hsp92II CATG 3 cut(s) 550, 637, 669
Ksp22I TGATCA 1 cut(s) 630
Kzo9I GATC 4 cut(s) 196, 225, 467, 630
Lsp1109I GCAGC 4 cut(s) 125, 445, 649, 664
MaeI CTAG 2 cut(s) 140, 386
MaeII ACGT 1 cut(s) 38
MalI GATC 4 cut(s) 198, 227, 469, 632
MboI GATC 4 cut(s) 196, 225, 467, 630
MboII GAAGA 1 cut(s) 10
MflI RGATCY 1 cut(s) 467
MluCI AATT 3 cut(s) 209, 302, 389
MlyI GAGTC 1 cut(s) 312
MnlI CCTC 9 cut(s) 57, 84, 112, 372, 374, 415, 592, 634, 666
MseI TTAA 1 cut(s) 108
MslI CAYNNNNRTG 1 cut(s) 364
MspA1I CMGCKG 2 cut(s) 116, 648
MspI CCGG 1 cut(s) 596
MspR9I CCNGG 3 cut(s) 397, 581, 596
Mva1269I GAATGC 1 cut(s) 638
MvaI CCWGG 2 cut(s) 397, 581
MwoI GCNNNNNNNGC 1 cut(s) 502
NciI CCSGG 1 cut(s) 596
NdeII GATC 4 cut(s) 196, 225, 467, 630
NlaIII CATG 3 cut(s) 550, 637, 669
NlaIV GGNNCC 3 cut(s) 100, 360, 376
NmeAIII GCCGAG 1 cut(s) 75
NspI RCATGY 1 cut(s) 669
OliI CACNNNNGTG 1 cut(s) 364
PceI AGGCCT 1 cut(s) 417
PctI GAATGC 1 cut(s) 638
PfeI GAWTC 3 cut(s) 31, 338, 508
PflMI CCANNNNNTGG 1 cut(s) 355
PfoI TCCNGGA 1 cut(s) 594
PkrI GCNGC 4 cut(s) 115, 460, 654, 664
PleI GAGTC 1 cut(s) 312
PpsI GAGTC 1 cut(s) 312
Psp6I CCWGG 2 cut(s) 395, 579
PspFI CCCAGC 1 cut(s) 530
PspGI CCWGG 2 cut(s) 395, 579
PspN4I GGNNCC 3 cut(s) 100, 360, 376
PspPI GGNCC 2 cut(s) 44, 675
PsuI RGATCY 1 cut(s) 467
PvuII CAGCTG 2 cut(s) 116, 648
RseI CAYNNNNRTG 1 cut(s) 364
SaqAI TTAA 1 cut(s) 108
SatI GCNGC 4 cut(s) 114, 459, 653, 663
Sau3AI GATC 4 cut(s) 196, 225, 467, 630
Sau96I GGNCC 2 cut(s) 44, 675
SchI GAGTC 1 cut(s) 312
ScrFI CCNGG 3 cut(s) 397, 581, 596
SinI GGWCC 1 cut(s) 44
SmiMI CAYNNNNRTG 1 cut(s) 364
SmlI CTYRAG 2 cut(s) 170, 419
SmoI CTYRAG 2 cut(s) 170, 419
Sse9I AATT 3 cut(s) 209, 302, 389
SseBI AGGCCT 1 cut(s) 417
SsiI CCGC 1 cut(s) 66
SspMI CTAG 2 cut(s) 140, 386
StuI AGGCCT 1 cut(s) 417
StyD4I CCNGG 3 cut(s) 395, 579, 594
TaaI ACNGT 2 cut(s) 7, 26
TaiI ACGT 1 cut(s) 41
TaqI TCGA 1 cut(s) 195
TasI AATT 3 cut(s) 209, 302, 389
TfiI GAWTC 3 cut(s) 31, 338, 508
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TscAI CASTG 1 cut(s) 318
TseI GCWGC 4 cut(s) 113, 458, 652, 662
TspDTI ATGAA 3 cut(s) 201, 223, 631
TspRI CASTG 1 cut(s) 318
Van91I CCANNNNNTGG 1 cut(s) 355
VpaK11BI GGWCC 1 cut(s) 44
XapI RAATTY 2 cut(s) 302, 389
XceI RCATGY 1 cut(s) 669
XmiI GTMKAC 1 cut(s) 57
XspI CTAG 2 cut(s) 140, 386
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.