Rh7DG481700

ABC transporter I family member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0001882
Physical Location & Seq
Reverse (-)
68691771 .. 68692088
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG481700.1

Sequence Viewer

Length: 318 bp
ATGATCCTCAGGATTCTCGGAGGCAAGCACATGGTCGACCCCAGCATGGTCCGGGTTCTGGGTCGCTCGGATTTCCACGACACCGCTCTTACCGGCTTCGGCAACCTGTCATACCTAGGCGGAGAGTGGCGGCGTGACGTGGCGTTTGCTGGTTTCGACGTTACGATACAGATGGATGTTTCGGCTGATAAATTGATCAATGGGGTAGTTGGGATTGACCCACAAAGGAGAGCTGAGCTGATCAAGGTGTTGGATATTGATCTTTCATGGAGGTTGCATATTCATCCCGGTTATGTAATTTTTGTTTTTGGACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03018 map03018
Pfam Domains
Protein Families
ABC_tran

Protein Analysis

105

Amino Acids

11.76

Weight (kDa)

6.49

Isoelectric Point (pI)

25.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 86
AccI GTMKAC 1 cut(s) 36
AciI CCGC 3 cut(s) 84, 120, 130
AfiI CCNNNNNNNGG 2 cut(s) 46, 58
AjiI CACGTC 1 cut(s) 139
AluBI AGCT 2 cut(s) 233, 238
AluI AGCT 2 cut(s) 233, 238
ArsI GACNNNNNNTTYG 2 cut(s) 128, 160
AspA2I CCTAGG 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 49
AsuC2I CCSGG 2 cut(s) 53, 288
AvaII GGWCC 1 cut(s) 49
AvrII CCTAGG 1 cut(s) 115
AxyI CCTNAGG 1 cut(s) 8
BccI CCATC 1 cut(s) 166
BclI TGATCA 2 cut(s) 195, 240
BcnI CCSGG 2 cut(s) 53, 288
BfaI CTAG 1 cut(s) 116
BisI GCNGC 1 cut(s) 131
BlnI CCTAGG 1 cut(s) 115
BlpI GCTNAGC 1 cut(s) 234
BlsI GCNGC 1 cut(s) 132
Bme1390I CCNGG 2 cut(s) 53, 288
Bme18I GGWCC 1 cut(s) 49
BmgBI CACGTC 1 cut(s) 139
BmgT120I GGNCC 1 cut(s) 49
BmrFI CCNGG 2 cut(s) 53, 288
Bpu1102I GCTNAGC 1 cut(s) 234
BpuMI CCSGG 2 cut(s) 53, 288
BsaBI GATNNNNATC 1 cut(s) 258
BsaJI CCNNGG 1 cut(s) 115
Bsc4I CCNNNNNNNGG 2 cut(s) 46, 58
Bse118I RCCGGY 1 cut(s) 92
Bse21I CCTNAGG 1 cut(s) 8
Bse8I GATNNNNATC 1 cut(s) 258
BseDI CCNNGG 1 cut(s) 115
BseGI GGATG 2 cut(s) 181, 283
BseJI GATNNNNATC 1 cut(s) 258
BseLI CCNNNNNNNGG 2 cut(s) 46, 58
BseMII CTCAG 2 cut(s) 22, 225
BseYI CCCAGC 1 cut(s) 41
BsiSI CCGG 3 cut(s) 52, 93, 288
BslI CCNNNNNNNGG 2 cut(s) 46, 58
Bsp143I GATC 4 cut(s) 3, 195, 240, 259
Bsp1720I GCTNAGC 1 cut(s) 234
BspACI CCGC 3 cut(s) 84, 120, 130
BspCNI CTCAG 2 cut(s) 21, 226
BsrBI CCGCTC 1 cut(s) 86
BsrFI RCCGGY 1 cut(s) 92
BssAI RCCGGY 1 cut(s) 92
BssECI CCNNGG 1 cut(s) 115
BssMI GATC 4 cut(s) 3, 195, 240, 259
BssT1I CCWWGG 1 cut(s) 115
BstC8I GCNNGC 1 cut(s) 26
BstDEI CTNAG 2 cut(s) 8, 234
BstF5I GGATG 2 cut(s) 181, 283
BstKTI GATC 4 cut(s) 6, 198, 243, 262
BstMBI GATC 4 cut(s) 3, 195, 240, 259
BstSCI CCNGG 2 cut(s) 51, 286
Bsu36I CCTNAGG 1 cut(s) 8
BtrI CACGTC 1 cut(s) 139
BtsCI GGATG 2 cut(s) 181, 283
Cac8I GCNNGC 1 cut(s) 26
Cfr10I RCCGGY 1 cut(s) 92
Cfr13I GGNCC 1 cut(s) 49
CviAII CATG 3 cut(s) 31, 46, 267
CviJI RGCY 4 cut(s) 96, 185, 233, 238
CviKI_1 RGCY 4 cut(s) 96, 185, 233, 238
DdeI CTNAG 2 cut(s) 8, 234
DpnI GATC 4 cut(s) 5, 197, 242, 261
DpnII GATC 4 cut(s) 3, 195, 240, 259
EciI GGCGGA 1 cut(s) 135
Eco130I CCWWGG 1 cut(s) 115
Eco47I GGWCC 1 cut(s) 49
Eco81I CCTNAGG 1 cut(s) 8
EcoT14I CCWWGG 1 cut(s) 115
ErhI CCWWGG 1 cut(s) 115
FaeI CATG 3 cut(s) 34, 49, 270
FaiI YATR 6 cut(s) 32, 47, 112, 268, 279, 294
FatI CATG 3 cut(s) 30, 45, 266
FbaI TGATCA 2 cut(s) 195, 240
FblI GTMKAC 1 cut(s) 36
Fnu4HI GCNGC 1 cut(s) 131
FokI GGATG 2 cut(s) 188, 270
Fsp4HI GCNGC 1 cut(s) 131
FspBI CTAG 1 cut(s) 116
GluI GCNGC 1 cut(s) 131
GsaI CCCAGC 1 cut(s) 45
HapII CCGG 3 cut(s) 52, 93, 288
Hin1II CATG 3 cut(s) 34, 49, 270
HincII GTYRAC 1 cut(s) 37
HindII GTYRAC 1 cut(s) 37
HinfI GANTC 1 cut(s) 13
HpaII CCGG 3 cut(s) 52, 93, 288
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 2 cut(s) 20, 70
Hpy188III TCNNGA 1 cut(s) 10
Hpy8I GTNNAC 1 cut(s) 37
Hpy99I CGWCG 1 cut(s) 161
HpyCH4IV ACGT 2 cut(s) 138, 159
HpyCH4V TGCA 1 cut(s) 277
HpyF3I CTNAG 2 cut(s) 8, 234
HpySE526I ACGT 2 cut(s) 138, 159
Hsp92II CATG 3 cut(s) 34, 49, 270
Ksp22I TGATCA 2 cut(s) 195, 240
Kzo9I GATC 4 cut(s) 3, 195, 240, 259
LpnPI CCDG 7 cut(s) 44, 55, 65, 106, 119, 135, 301
MaeI CTAG 1 cut(s) 116
MaeII ACGT 2 cut(s) 138, 159
MaeIII GTNAC 2 cut(s) 134, 160
MalI GATC 4 cut(s) 5, 197, 242, 261
MbiI CCGCTC 1 cut(s) 86
MboI GATC 4 cut(s) 3, 195, 240, 259
MluCI AATT 2 cut(s) 191, 297
MmeI TCCRAC 1 cut(s) 231
MnlI CCTC 3 cut(s) 14, 17, 264
MspI CCGG 3 cut(s) 52, 93, 288
MspR9I CCNGG 2 cut(s) 53, 288
NciI CCSGG 2 cut(s) 53, 288
NdeII GATC 4 cut(s) 3, 195, 240, 259
NlaIII CATG 3 cut(s) 34, 49, 270
NmuCI GTSAC 1 cut(s) 134
PfeI GAWTC 1 cut(s) 13
PkrI GCNGC 1 cut(s) 132
PspFI CCCAGC 1 cut(s) 41
PspPI GGNCC 1 cut(s) 49
SalI GTCGAC 1 cut(s) 35
SatI GCNGC 1 cut(s) 131
Sau3AI GATC 4 cut(s) 3, 195, 240, 259
Sau96I GGNCC 1 cut(s) 49
ScrFI CCNGG 2 cut(s) 53, 288
SetI ASST 8 cut(s) 108, 117, 141, 162, 235, 240, 249, 275
SinI GGWCC 1 cut(s) 49
Sse9I AATT 2 cut(s) 191, 297
SsiI CCGC 3 cut(s) 84, 120, 130
SspMI CTAG 1 cut(s) 116
StyD4I CCNGG 2 cut(s) 51, 286
StyI CCWWGG 1 cut(s) 115
TaiI ACGT 2 cut(s) 141, 162
TaqI TCGA 2 cut(s) 36, 156
TasI AATT 2 cut(s) 191, 297
TauI GCSGC 1 cut(s) 133
TfiI GAWTC 1 cut(s) 13
TseFI GTSAC 1 cut(s) 134
Tsp45I GTSAC 1 cut(s) 134
TspDTI ATGAA 2 cut(s) 255, 272
VpaK11BI GGWCC 1 cut(s) 49
XmaJI CCTAGG 1 cut(s) 115
XmiI GTMKAC 1 cut(s) 36
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.