Rh1AG023900

Belongs to the peptidase S10 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
4271727 .. 4272547
821 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG023900.1

Sequence Viewer

Length: 495 bp
ATGGAAAAGGTCCCTATACTTGTTCTTGTTCTCCTTTTGGTGCCAACAGCAACTGCTGCTAGAACCCAAGATGGATCAGAGGACTGGGGCTATGTTGAAGTCCGACTCAAAGAACACATGTTCTGGTGGCTTTATAGAAGTCCTAACAGAGTTGAGGATCCCTCAAAGCCATGGCCAATTATTCTCTGGCTCCAAGGTGGACCTGGAGGTTCGGGAGTTGGGATTGGGAACTTTGAAGAGGTTGGGCCATTAGACACCAATGTGAAGCCAAGGAATTCAACGTGGTTGCAAAAGGCAGATCTTTTATTTGTGGATAACCCAGTTGGAACCGGATTCAGTTTTGTGGAGGACAACGCTCTGTTTGTGAAAAATGATGTGGAGGCAGCCACTGATTTGACAACATTACTAAAAGAGCTATTCAACAGAAATGAGAGCCTCCAGAAGAGTCTTCTGTTCATTGTCGCAGGGCCGGCAAACTCGCAAGGCCGGCCCTGA

Protein Analysis

164

Amino Acids

18.22

Weight (kDa)

4.89

Isoelectric Point (pI)

31.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S10 PF00450 24 - 154 4.2e-33 Serine carboxypeptidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 40
AclWI GGATC 3 cut(s) 82, 152, 165
AcoI YGGCCR 1 cut(s) 173
AcsI RAATTY 1 cut(s) 274
AflIII ACRYGT 1 cut(s) 117
AgsI TTSAA 4 cut(s) 98, 236, 279, 421
AjnI CCWGG 1 cut(s) 202
AleI CACNNNNGTG 1 cut(s) 260
AluBI AGCT 1 cut(s) 415
AluI AGCT 1 cut(s) 415
AlwI GGATC 3 cut(s) 82, 152, 165
AlwNI CAGNNNCTG 2 cut(s) 53, 389
AoxI GGCC 5 cut(s) 173, 245, 467, 484, 488
ApeKI GCWGC 2 cut(s) 56, 383
ApoI RAATTY 1 cut(s) 274
AspS9I GGNCC 5 cut(s) 10, 200, 245, 467, 489
AvaII GGWCC 2 cut(s) 10, 200
BalI TGGCCA 1 cut(s) 175
BamHI GGATCC 1 cut(s) 157
BanI GGYRCC 1 cut(s) 40
BbsI GAAGAC 1 cut(s) 440
BbvI GCAGC 2 cut(s) 43, 395
BccI CCATC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 204
BfaI CTAG 1 cut(s) 60
BglII AGATCT 1 cut(s) 298
BisI GCNGC 2 cut(s) 57, 384
BlsI GCNGC 2 cut(s) 58, 385
Bme1390I CCNGG 1 cut(s) 204
Bme18I GGWCC 2 cut(s) 10, 200
BmgT120I GGNCC 5 cut(s) 10, 200, 245, 467, 489
BmiI GGNNCC 5 cut(s) 12, 42, 159, 191, 328
BmrFI CCNGG 1 cut(s) 204
BmrI ACTGGG 2 cut(s) 94, 314
BmuI ACTGGG 2 cut(s) 94, 314
BpiI GAAGAC 1 cut(s) 440
BplI GAGNNNNNCTC 2 cut(s) 146, 178
BpmI CTGGAG 2 cut(s) 225, 422
BsaJI CCNNGG 3 cut(s) 170, 193, 269
BsaWI WCCGGW 1 cut(s) 329
Bse118I RCCGGY 2 cut(s) 469, 486
Bse1I ACTGG 2 cut(s) 89, 320
BseBI CCWGG 1 cut(s) 204
BseDI CCNNGG 3 cut(s) 170, 193, 269
BseNI ACTGG 2 cut(s) 89, 320
BseXI GCAGC 2 cut(s) 43, 395
BshFI GGCC 5 cut(s) 175, 247, 469, 486, 490
BshNI GGYRCC 1 cut(s) 40
BsiSI CCGG 3 cut(s) 330, 470, 487
BsnI GGCC 5 cut(s) 175, 247, 469, 486, 490
Bsp143I GATC 3 cut(s) 74, 157, 298
Bsp19I CCATGG 1 cut(s) 170
BspANI GGCC 5 cut(s) 175, 247, 469, 486, 490
BspLI GGNNCC 5 cut(s) 12, 42, 159, 191, 328
BspPI GGATC 3 cut(s) 82, 152, 165
BspT107I GGYRCC 1 cut(s) 40
BsrFI RCCGGY 2 cut(s) 469, 486
BsrI ACTGG 2 cut(s) 89, 320
BssAI RCCGGY 2 cut(s) 469, 486
BssECI CCNNGG 3 cut(s) 170, 193, 269
BssMI GATC 3 cut(s) 74, 157, 298
BssT1I CCWWGG 3 cut(s) 170, 193, 269
Bst2UI CCWGG 1 cut(s) 204
Bst6I CTCTTC 2 cut(s) 231, 437
BstAPI GCANNNNNTGC 1 cut(s) 56
BstC8I GCNNGC 2 cut(s) 471, 488
BstDSI CCRYGG 1 cut(s) 170
BstKTI GATC 3 cut(s) 77, 160, 301
BstMBI GATC 3 cut(s) 74, 157, 298
BstMWI GCNNNNNNNGC 3 cut(s) 56, 470, 487
BstNI CCWGG 1 cut(s) 204
BstNSI RCATGY 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 202
BstV1I GCAGC 2 cut(s) 43, 395
BstV2I GAAGAC 1 cut(s) 440
BstX2I RGATCY 2 cut(s) 157, 298
BstYI RGATCY 2 cut(s) 157, 298
BsuRI GGCC 5 cut(s) 175, 247, 469, 486, 490
BtgI CCRYGG 1 cut(s) 170
BtsIMutI CAGTG 1 cut(s) 387
Cac8I GCNNGC 2 cut(s) 471, 488
CaiI CAGNNNCTG 2 cut(s) 53, 389
Cfr10I RCCGGY 2 cut(s) 469, 486
Cfr13I GGNCC 5 cut(s) 10, 200, 245, 467, 489
CviAII CATG 2 cut(s) 118, 171
DpnI GATC 3 cut(s) 76, 159, 300
DpnII GATC 3 cut(s) 74, 157, 298
EaeI YGGCCR 1 cut(s) 173
Eam1104I CTCTTC 2 cut(s) 231, 437
EarI CTCTTC 2 cut(s) 231, 437
Eco130I CCWWGG 3 cut(s) 170, 193, 269
Eco47I GGWCC 2 cut(s) 10, 200
EcoO109I RGGNCCY 1 cut(s) 10
EcoRI GAATTC 1 cut(s) 274
EcoRII CCWGG 1 cut(s) 202
EcoT14I CCWWGG 3 cut(s) 170, 193, 269
ErhI CCWWGG 3 cut(s) 170, 193, 269
FaeI CATG 2 cut(s) 121, 174
FaiI YATR 5 cut(s) 17, 93, 119, 135, 172
FatI CATG 2 cut(s) 117, 170
Fnu4HI GCNGC 2 cut(s) 57, 384
FseI GGCCGGCC 1 cut(s) 490
Fsp4HI GCNGC 2 cut(s) 57, 384
FspBI CTAG 1 cut(s) 60
GluI GCNGC 2 cut(s) 57, 384
GsuI CTGGAG 2 cut(s) 225, 422
HaeIII GGCC 5 cut(s) 175, 247, 469, 486, 490
HapII CCGG 3 cut(s) 330, 470, 487
Hin1II CATG 2 cut(s) 121, 174
HinfI GANTC 3 cut(s) 105, 333, 445
HpaII CCGG 3 cut(s) 330, 470, 487
Hpy166II GTNNAC 1 cut(s) 200
Hpy188I TCNGA 2 cut(s) 79, 104
Hpy188III TCNNGA 2 cut(s) 213, 439
Hpy8I GTNNAC 1 cut(s) 200
HpyCH4IV ACGT 1 cut(s) 281
HpyCH4V TGCA 1 cut(s) 289
HpyF10VI GCNNNNNNNGC 3 cut(s) 56, 470, 487
HpySE526I ACGT 1 cut(s) 281
Hsp92II CATG 2 cut(s) 121, 174
KroI GCCGGC 2 cut(s) 469, 486
KroNI GCCGGC 2 cut(s) 471, 488
Kzo9I GATC 3 cut(s) 74, 157, 298
LmnI GCTCC 1 cut(s) 195
Lsp1109I GCAGC 2 cut(s) 43, 395
MaeI CTAG 1 cut(s) 60
MaeII ACGT 1 cut(s) 281
MalI GATC 3 cut(s) 76, 159, 300
MboI GATC 3 cut(s) 74, 157, 298
MboII GAAGA 3 cut(s) 248, 440, 454
MflI RGATCY 2 cut(s) 157, 298
MlsI TGGCCA 1 cut(s) 175
MluCI AATT 2 cut(s) 177, 274
MluNI TGGCCA 1 cut(s) 175
MlyI GAGTC 2 cut(s) 99, 454
MmeI TCCRAC 2 cut(s) 127, 304
MnlI CCTC 8 cut(s) 73, 148, 172, 200, 232, 340, 373, 446
Mox20I TGGCCA 1 cut(s) 175
MroNI GCCGGC 2 cut(s) 469, 486
MscI TGGCCA 1 cut(s) 175
MslI CAYNNNNRTG 1 cut(s) 260
Msp20I TGGCCA 1 cut(s) 175
MspI CCGG 3 cut(s) 330, 470, 487
MspR9I CCNGG 1 cut(s) 204
MvaI CCWGG 1 cut(s) 204
MwoI GCNNNNNNNGC 3 cut(s) 56, 470, 487
NaeI GCCGGC 2 cut(s) 471, 488
NcoI CCATGG 1 cut(s) 170
NdeII GATC 3 cut(s) 74, 157, 298
NgoMIV GCCGGC 2 cut(s) 469, 486
NlaIII CATG 2 cut(s) 121, 174
NlaIV GGNNCC 5 cut(s) 12, 42, 159, 191, 328
NspI RCATGY 1 cut(s) 121
OliI CACNNNNGTG 1 cut(s) 260
PciI ACATGT 1 cut(s) 117
PdiI GCCGGC 2 cut(s) 471, 488
PfeI GAWTC 1 cut(s) 333
PkrI GCNGC 2 cut(s) 58, 385
PleI GAGTC 2 cut(s) 99, 453
PpsI GAGTC 2 cut(s) 99, 453
PpuMI RGGWCCY 1 cut(s) 10
PscI ACATGT 1 cut(s) 117
Psp5II RGGWCCY 1 cut(s) 10
Psp6I CCWGG 1 cut(s) 202
PspGI CCWGG 1 cut(s) 202
PspN4I GGNNCC 5 cut(s) 12, 42, 159, 191, 328
PspPI GGNCC 5 cut(s) 10, 200, 245, 467, 489
PspPPI RGGWCCY 1 cut(s) 10
PstNI CAGNNNCTG 2 cut(s) 53, 389
PsuI RGATCY 2 cut(s) 157, 298
RigI GGCCGGCC 1 cut(s) 490
RseI CAYNNNNRTG 1 cut(s) 260
SatI GCNGC 2 cut(s) 57, 384
Sau3AI GATC 3 cut(s) 74, 157, 298
Sau96I GGNCC 5 cut(s) 10, 200, 245, 467, 489
SchI GAGTC 2 cut(s) 99, 454
ScrFI CCNGG 1 cut(s) 204
SetI ASST 7 cut(s) 12, 199, 205, 211, 243, 284, 417
SinI GGWCC 2 cut(s) 10, 200
SmiMI CAYNNNNRTG 1 cut(s) 260
Sse9I AATT 2 cut(s) 177, 274
SspMI CTAG 1 cut(s) 60
StyD4I CCNGG 1 cut(s) 202
StyI CCWWGG 3 cut(s) 170, 193, 269
TaiI ACGT 1 cut(s) 284
TasI AATT 2 cut(s) 177, 274
TfiI GAWTC 1 cut(s) 333
TscAI CASTG 1 cut(s) 394
TseI GCWGC 2 cut(s) 56, 383
TspDTI ATGAA 1 cut(s) 445
TspRI CASTG 1 cut(s) 394
VpaK11BI GGWCC 2 cut(s) 10, 200
XapI RAATTY 1 cut(s) 274
XceI RCATGY 1 cut(s) 121
XcmI CCANNNNNNNNNTGG 2 cut(s) 183, 200
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.