Rh1BG373700
MYB Family

response regulator

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
50478962 .. 50480649
1688 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG373700.1

Sequence Viewer

Length: 303 bp
ATGGATGCAGAGGGAGTTGTTGATCGAGGGAGGCAGTACTCTGCCAATATCAATATCTTGCTTGTCGACGATGATATCACCACTCTAAACATAGTTTCTGCAATGCTCAAAACATGGAGCTATGAAGTTGTGACTGTTCCGAACCCTATAGATGCTATTTCTATCCTTCGAAAGGGAAAATGCTCCTTTGATCTAGTTGTTACAGATCTCCACATGCCTCAGATGAATGGTTTGGAATTGCAGAAGCTAGTGCATGATGAGTTTGAGCTACCCGTCATTAGTGAGTTCATGTCTTTAGTTTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.22

Weight (kDa)

4.4

Isoelectric Point (pI)

38.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Response_reg PF00072 19 - 93 1.7e-13 Response regulator receiver domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 66
AfaI GTAC 1 cut(s) 38
AfiI CCNNNNNNNGG 1 cut(s) 172
AluBI AGCT 3 cut(s) 120, 247, 268
AluI AGCT 3 cut(s) 120, 247, 268
AsuHPI GGTGA 1 cut(s) 70
AsuII TTCGAA 1 cut(s) 169
BfaI CTAG 2 cut(s) 194, 248
BfmI CTRYAG 1 cut(s) 147
BglII AGATCT 1 cut(s) 205
BmcAI AGTACT 1 cut(s) 38
BmsI GCATC 1 cut(s) 142
Bpu14I TTCGAA 1 cut(s) 169
Bsc4I CCNNNNNNNGG 1 cut(s) 172
Bse3DI GCAATG 1 cut(s) 108
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 172
BseMI GCAATG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 233
BslI CCNNNNNNNGG 1 cut(s) 172
Bsp119I TTCGAA 1 cut(s) 169
Bsp143I GATC 3 cut(s) 22, 190, 205
BspCNI CTCAG 1 cut(s) 232
BspT104I TTCGAA 1 cut(s) 169
BsrDI GCAATG 1 cut(s) 108
BssMI GATC 3 cut(s) 22, 190, 205
Bst4CI ACNGT 1 cut(s) 136
BstBI TTCGAA 1 cut(s) 169
BstDEI CTNAG 1 cut(s) 219
BstENI CCTNNNNNAGG 1 cut(s) 170
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 3 cut(s) 25, 193, 208
BstMBI GATC 3 cut(s) 22, 190, 205
BstNSI RCATGY 1 cut(s) 217
BstSFI CTRYAG 1 cut(s) 147
BstX2I RGATCY 1 cut(s) 205
BstYI RGATCY 1 cut(s) 205
BtsCI GGATG 1 cut(s) 10
Csp6I GTAC 1 cut(s) 37
CviAII CATG 4 cut(s) 114, 214, 254, 289
CviJI RGCY 3 cut(s) 120, 247, 268
CviKI_1 RGCY 3 cut(s) 120, 247, 268
CviQI GTAC 1 cut(s) 37
DdeI CTNAG 1 cut(s) 219
DpnI GATC 3 cut(s) 24, 192, 207
DpnII GATC 3 cut(s) 22, 190, 205
Eco32I GATATC 1 cut(s) 76
EcoNI CCTNNNNNAGG 1 cut(s) 170
EcoRV GATATC 1 cut(s) 76
FaeI CATG 4 cut(s) 117, 217, 257, 292
FaiI YATR 7 cut(s) 92, 115, 123, 149, 215, 255, 290
FatI CATG 4 cut(s) 113, 213, 253, 288
FblI GTMKAC 1 cut(s) 66
FokI GGATG 1 cut(s) 17
FspBI CTAG 2 cut(s) 194, 248
Hin1II CATG 4 cut(s) 117, 217, 257, 292
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HphI GGTGA 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 67
Hpy188I TCNGA 2 cut(s) 141, 222
Hpy8I GTNNAC 1 cut(s) 67
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 176
HpyCH4III ACNGT 1 cut(s) 136
HpyCH4V TGCA 4 cut(s) 8, 101, 241, 253
HpyF3I CTNAG 1 cut(s) 219
Hsp92II CATG 4 cut(s) 117, 217, 257, 292
Kzo9I GATC 3 cut(s) 22, 190, 205
LmnI GCTCC 2 cut(s) 117, 188
LweI GCATC 1 cut(s) 142
MaeI CTAG 2 cut(s) 194, 248
MaeIII GTNAC 2 cut(s) 130, 199
MalI GATC 3 cut(s) 24, 192, 207
MboI GATC 3 cut(s) 22, 190, 205
MflI RGATCY 1 cut(s) 205
MluCI AATT 1 cut(s) 236
MnlI CCTC 4 cut(s) 4, 20, 24, 228
MseI TTAA 1 cut(s) 301
NdeII GATC 3 cut(s) 22, 190, 205
NlaIII CATG 4 cut(s) 117, 217, 257, 292
NmuCI GTSAC 1 cut(s) 130
NspI RCATGY 1 cut(s) 217
NspV TTCGAA 1 cut(s) 169
PsuI RGATCY 1 cut(s) 205
RsaI GTAC 1 cut(s) 38
RsaNI GTAC 1 cut(s) 37
SalI GTCGAC 1 cut(s) 65
SaqAI TTAA 1 cut(s) 301
Sau3AI GATC 3 cut(s) 22, 190, 205
ScaI AGTACT 1 cut(s) 38
SetI ASST 3 cut(s) 122, 249, 270
SfaNI GCATC 1 cut(s) 142
SfcI CTRYAG 1 cut(s) 147
SfuI TTCGAA 1 cut(s) 169
SgeI CNNG 9 cut(s) 38, 70, 74, 126, 206, 226, 260, 266, 284
Sse9I AATT 1 cut(s) 236
SspMI CTAG 2 cut(s) 194, 248
TaaI ACNGT 1 cut(s) 136
TaqI TCGA 3 cut(s) 25, 66, 169
TasI AATT 1 cut(s) 236
TatI WGTACW 1 cut(s) 36
Tru1I TTAA 1 cut(s) 301
Tru9I TTAA 1 cut(s) 301
TseFI GTSAC 1 cut(s) 130
Tsp45I GTSAC 1 cut(s) 130
TspDTI ATGAA 3 cut(s) 138, 239, 277
XagI CCTNNNNNAGG 1 cut(s) 170
XceI RCATGY 1 cut(s) 217
XmiI GTMKAC 1 cut(s) 66
XspI CTAG 2 cut(s) 194, 248
ZrmI AGTACT 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.