Rh1CG034900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
6727747 .. 6727935
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG034900.1

Sequence Viewer

Length: 189 bp
ATGCCAATCCCAGTGGCAGACGTCGAGGCGGAGGCAAGACAAAGGCTTTCTGGTGCTGAAGCGGAATCAGAAAGAGGCACTGCAGCTGGCGAAAAAGGCAGAATTGAACATATTGAGGCTACCCAGGTTGAGAATCTGAAATATGCATATATGGTGTTTGATGGAATGCCTGAGAGAACCCTTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.83

Weight (kDa)

4.7

Isoelectric Point (pI)

59.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 24
AciI CCGC 2 cut(s) 29, 62
AcuI CTGAAG 1 cut(s) 78
AcyI GRCGYC 1 cut(s) 21
AgsI TTSAA 1 cut(s) 107
AjnI CCWGG 1 cut(s) 123
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
ApeKI GCWGC 1 cut(s) 83
BbvI GCAGC 1 cut(s) 95
BccI CCATC 1 cut(s) 155
BciT130I CCWGG 1 cut(s) 125
BfmI CTRYAG 1 cut(s) 81
BisI GCNGC 1 cut(s) 84
BlsI GCNGC 1 cut(s) 85
Bme1390I CCNGG 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 125
BmrI ACTGGG 1 cut(s) 5
BmuI ACTGGG 1 cut(s) 5
BsaHI GRCGYC 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 123
Bse1I ACTGG 1 cut(s) 11
BseBI CCWGG 1 cut(s) 125
BseDI CCNNGG 1 cut(s) 123
BseMII CTCAG 1 cut(s) 162
BseNI ACTGG 1 cut(s) 11
BseXI GCAGC 1 cut(s) 95
BsmI GAATGC 1 cut(s) 171
BspACI CCGC 2 cut(s) 29, 62
BspCNI CTCAG 1 cut(s) 163
BspMAI CTGCAG 1 cut(s) 85
BsrI ACTGG 1 cut(s) 11
BssECI CCNNGG 1 cut(s) 123
BssNI GRCGYC 1 cut(s) 21
Bst2UI CCWGG 1 cut(s) 125
BstACI GRCGYC 1 cut(s) 21
BstC8I GCNNGC 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 171
BstMWI GCNNNNNNNGC 1 cut(s) 96
BstNI CCWGG 1 cut(s) 125
BstSCI CCNGG 1 cut(s) 123
BstSFI CTRYAG 1 cut(s) 81
BstV1I GCAGC 1 cut(s) 95
BtsI GCAGTG 1 cut(s) 78
BtsIMutI CAGTG 2 cut(s) 18, 78
Cac8I GCNNGC 1 cut(s) 88
CspCI CAANNNNNGTGG 1 cut(s) 29
CviJI RGCY 3 cut(s) 46, 86, 119
CviKI_1 RGCY 3 cut(s) 46, 86, 119
DdeI CTNAG 1 cut(s) 171
EciI GGCGGA 1 cut(s) 44
Eco57I CTGAAG 1 cut(s) 78
EcoRII CCWGG 1 cut(s) 123
EcoT22I ATGCAT 1 cut(s) 148
FaiI YATR 5 cut(s) 111, 144, 148, 150, 152
Fnu4HI GCNGC 1 cut(s) 84
Fsp4HI GCNGC 1 cut(s) 84
GluI GCNGC 1 cut(s) 84
Hin1I GRCGYC 1 cut(s) 21
HinfI GANTC 2 cut(s) 65, 133
Hpy188I TCNGA 2 cut(s) 70, 138
Hpy99I CGWCG 1 cut(s) 26
HpyCH4IV ACGT 1 cut(s) 21
HpyCH4V TGCA 2 cut(s) 83, 146
HpyF10VI GCNNNNNNNGC 1 cut(s) 96
HpyF3I CTNAG 1 cut(s) 171
HpySE526I ACGT 1 cut(s) 21
Hsp92I GRCGYC 1 cut(s) 21
LpnPI CCDG 6 cut(s) 24, 36, 72, 110, 137, 183
Lsp1109I GCAGC 1 cut(s) 95
MaeII ACGT 1 cut(s) 21
MluCI AATT 1 cut(s) 102
MnlI CCTC 4 cut(s) 19, 25, 68, 109
Mph1103I ATGCAT 1 cut(s) 148
MspA1I CMGCKG 1 cut(s) 86
MspR9I CCNGG 1 cut(s) 125
Mva1269I GAATGC 1 cut(s) 171
MvaI CCWGG 1 cut(s) 125
MwoI GCNNNNNNNGC 1 cut(s) 96
NsiI ATGCAT 1 cut(s) 148
PctI GAATGC 1 cut(s) 171
PfeI GAWTC 2 cut(s) 65, 133
PkrI GCNGC 1 cut(s) 85
Psp6I CCWGG 1 cut(s) 123
PspGI CCWGG 1 cut(s) 123
PstI CTGCAG 1 cut(s) 85
PvuII CAGCTG 1 cut(s) 86
SatI GCNGC 1 cut(s) 84
ScrFI CCNGG 1 cut(s) 125
SetI ASST 3 cut(s) 24, 88, 129
SfcI CTRYAG 1 cut(s) 81
SgeI CNNG 8 cut(s) 23, 37, 48, 63, 99, 136, 137, 182
Sse9I AATT 1 cut(s) 102
SsiI CCGC 2 cut(s) 29, 62
StyD4I CCNGG 1 cut(s) 123
TaiI ACGT 1 cut(s) 24
TaqI TCGA 1 cut(s) 24
TasI AATT 1 cut(s) 102
TfiI GAWTC 2 cut(s) 65, 133
TscAI CASTG 2 cut(s) 18, 85
TseI GCWGC 1 cut(s) 83
TspRI CASTG 2 cut(s) 18, 85
ZraI GACGTC 1 cut(s) 22
Zsp2I ATGCAT 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.