Rh4AG193000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0002526
Physical Location & Seq
Forward (+)
47429091 .. 47430275
1185 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG193000.1

Sequence Viewer

Length: 306 bp
ATGATAAATTTGATCTCTCATGTGTTTTTAACTTGTTTCTTGAATATTTACAGCAAGGCGGAGAAGGATCGCTTAAACCTGAAGAATGCGCGGGAAAGTGTGATTTTCGGTGTTCAGCAACTTCACACAAGAAGCCATGTCTGTTCTTTTGCAACATGTGTTGTCAAAAATGTCTCTGTGTCCCATCGGGCACATATGGACACAAAGAAGAATGTCCATGCTACAACAACTGGAAAACCCAGGAAGGAGGTCCCAAATGCCCTTGAAGATATAATTGCAATGTTAATTATGAGAAAAATACAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.49

Weight (kDa)

9.88

Isoelectric Point (pI)

15.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 91
AciI CCGC 2 cut(s) 59, 91
AclWI GGATC 1 cut(s) 75
AcsI RAATTY 1 cut(s) 7
AcuI CTGAAG 1 cut(s) 101
AflIII ACRYGT 1 cut(s) 155
AgsI TTSAA 2 cut(s) 43, 266
AjnI CCWGG 1 cut(s) 239
Alw26I GTCTC 1 cut(s) 178
AlwI GGATC 1 cut(s) 75
ApoI RAATTY 1 cut(s) 7
AspLEI GCGC 1 cut(s) 91
AspS9I GGNCC 1 cut(s) 250
AvaII GGWCC 1 cut(s) 250
BaeGI GKGCMC 1 cut(s) 193
BccI CCATC 1 cut(s) 192
BciT130I CCWGG 1 cut(s) 241
BcoDI GTCTC 1 cut(s) 178
Bme1390I CCNGG 1 cut(s) 241
Bme18I GGWCC 1 cut(s) 250
BmgT120I GGNCC 1 cut(s) 250
BmiI GGNNCC 1 cut(s) 252
BmrFI CCNGG 1 cut(s) 241
BsaJI CCNNGG 1 cut(s) 239
Bse1I ACTGG 1 cut(s) 235
Bse3DI GCAATG 1 cut(s) 285
BseBI CCWGG 1 cut(s) 241
BseDI CCNNGG 1 cut(s) 239
BseMI GCAATG 1 cut(s) 285
BseNI ACTGG 1 cut(s) 235
BseSI GKGCMC 1 cut(s) 193
Bsh1236I CGCG 1 cut(s) 91
BslFI GGGAC 2 cut(s) 166, 236
BsmAI GTCTC 1 cut(s) 178
BsmFI GGGAC 2 cut(s) 166, 236
BsmI GAATGC 1 cut(s) 91
Bsp1286I GDGCHC 1 cut(s) 193
Bsp143I GATC 2 cut(s) 12, 67
BspACI CCGC 2 cut(s) 59, 91
BspFNI CGCG 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 252
BspPI GGATC 1 cut(s) 75
BsrDI GCAATG 1 cut(s) 285
BsrI ACTGG 1 cut(s) 235
BssECI CCNNGG 1 cut(s) 239
BssMI GATC 2 cut(s) 12, 67
Bst2UI CCWGG 1 cut(s) 241
BstFNI CGCG 1 cut(s) 91
BstHHI GCGC 1 cut(s) 91
BstKTI GATC 2 cut(s) 15, 70
BstMAI GTCTC 1 cut(s) 178
BstMBI GATC 2 cut(s) 12, 67
BstNI CCWGG 1 cut(s) 241
BstNSI RCATGY 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 239
BstSLI GKGCMC 1 cut(s) 193
BstUI CGCG 1 cut(s) 91
CfoI GCGC 1 cut(s) 91
Cfr13I GGNCC 1 cut(s) 250
CviAII CATG 4 cut(s) 20, 137, 156, 218
CviJI RGCY 1 cut(s) 135
CviKI_1 RGCY 1 cut(s) 135
DpnI GATC 2 cut(s) 14, 69
DpnII GATC 2 cut(s) 12, 67
EciI GGCGGA 1 cut(s) 74
Eco47I GGWCC 1 cut(s) 250
Eco57I CTGAAG 1 cut(s) 101
EcoO109I RGGNCCY 1 cut(s) 250
EcoRII CCWGG 1 cut(s) 239
FaeI CATG 4 cut(s) 23, 140, 159, 221
FaiI YATR 8 cut(s) 21, 138, 157, 195, 197, 219, 272, 290
FalI AAGNNNNNCTT 2 cut(s) 56, 88
FaqI GGGAC 2 cut(s) 166, 236
FatI CATG 4 cut(s) 19, 136, 155, 217
FauI CCCGC 1 cut(s) 84
FauNDI CATATG 1 cut(s) 195
GlaI GCGC 1 cut(s) 90
HhaI GCGC 1 cut(s) 91
Hin1II CATG 4 cut(s) 23, 140, 159, 221
Hin6I GCGC 1 cut(s) 89
HinP1I GCGC 1 cut(s) 89
Hpy188III TCNNGA 1 cut(s) 40
HpyAV CCTTC 2 cut(s) 58, 238
HpyCH4V TGCA 2 cut(s) 152, 278
Hsp92II CATG 4 cut(s) 23, 140, 159, 221
HspAI GCGC 1 cut(s) 89
Kzo9I GATC 2 cut(s) 12, 67
LpnPI CCDG 4 cut(s) 92, 216, 226, 253
MalI GATC 2 cut(s) 14, 69
MboI GATC 2 cut(s) 12, 67
MboII GAAGA 3 cut(s) 94, 220, 278
MhlI GDGCHC 1 cut(s) 193
MluCI AATT 3 cut(s) 7, 273, 285
MnlI CCTC 1 cut(s) 241
MseI TTAA 3 cut(s) 29, 74, 284
MspR9I CCNGG 1 cut(s) 241
Mva1269I GAATGC 1 cut(s) 91
MvaI CCWGG 1 cut(s) 241
MvnI CGCG 1 cut(s) 91
NdeI CATATG 1 cut(s) 195
NdeII GATC 2 cut(s) 12, 67
NlaIII CATG 4 cut(s) 23, 140, 159, 221
NlaIV GGNNCC 1 cut(s) 252
NspI RCATGY 1 cut(s) 159
PciI ACATGT 1 cut(s) 155
PctI GAATGC 1 cut(s) 91
PpuMI RGGWCCY 1 cut(s) 250
PscI ACATGT 1 cut(s) 155
Psp5II RGGWCCY 1 cut(s) 250
Psp6I CCWGG 1 cut(s) 239
PspGI CCWGG 1 cut(s) 239
PspN4I GGNNCC 1 cut(s) 252
PspPI GGNCC 1 cut(s) 250
PspPPI RGGWCCY 1 cut(s) 250
SaqAI TTAA 3 cut(s) 29, 74, 284
Sau3AI GATC 2 cut(s) 12, 67
Sau96I GGNCC 1 cut(s) 250
ScrFI CCNGG 1 cut(s) 241
SduI GDGCHC 1 cut(s) 193
SetI ASST 2 cut(s) 81, 252
SinI GGWCC 1 cut(s) 250
Sse9I AATT 3 cut(s) 7, 273, 285
SsiI CCGC 2 cut(s) 59, 91
SspI AATATT 1 cut(s) 46
StyD4I CCNGG 1 cut(s) 239
TasI AATT 3 cut(s) 7, 273, 285
Tru1I TTAA 3 cut(s) 29, 74, 284
Tru9I TTAA 3 cut(s) 29, 74, 284
VpaK11BI GGWCC 1 cut(s) 250
XapI RAATTY 1 cut(s) 7
XceI RCATGY 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.