Rh4CG412100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
65733919 .. 65735328
1410 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG412100.1

Sequence Viewer

Length: 300 bp
ATGTTCGACTGGGTTCGAGACTTCGAGGCTTCGACTGGGATCGATTGGGTTCGACACTTTGAGGCTTCGACTGGGTTCGACACTTTGAGGCTTCAACTGGGATCGACTGGGTTCGAGACTTCTAGGCTTCGAGGCTTCGACTGGGTTCGAAGAATTGAGTTCTCGGGGATGGCTGCGAATCGACTAGGTTCGAAGAACTGGGAACCGAGGTCTCGGGGATGGCTGCGAATCGACTGGGAAGAACTGGGACTTGAGGTCTCGGGGATGGGGTTCGAAGAAAGTTTGCGTCTGAAAGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.58

Weight (kDa)

5.42

Isoelectric Point (pI)

44.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 47, 109
AgsI TTSAA 1 cut(s) 95
AhdI GACNNNNNGTC 1 cut(s) 254
Alw26I GTCTC 4 cut(s) 12, 110, 216, 262
AlwI GGATC 2 cut(s) 47, 109
Ama87I CYCGRG 3 cut(s) 163, 213, 259
ApeKI GCWGC 2 cut(s) 173, 223
AsuII TTCGAA 3 cut(s) 148, 191, 273
AvaI CYCGRG 3 cut(s) 163, 213, 259
BbvI GCAGC 2 cut(s) 160, 210
BccI CCATC 3 cut(s) 163, 213, 259
BcoDI GTCTC 4 cut(s) 12, 110, 216, 262
BfaI CTAG 2 cut(s) 123, 185
BisI GCNGC 2 cut(s) 174, 224
BlsI GCNGC 2 cut(s) 175, 225
BmeRI GACNNNNNGTC 1 cut(s) 254
BmeT110I CYCGRG 3 cut(s) 163, 213, 259
BmiI GGNNCC 1 cut(s) 204
BmrI ACTGGG 9 cut(s) 19, 45, 81, 107, 117, 151, 208, 244, 254
BmuI ACTGGG 9 cut(s) 19, 45, 81, 107, 117, 151, 208, 244, 254
Bpu14I TTCGAA 3 cut(s) 148, 191, 273
BpuEI CTTGAG 1 cut(s) 272
Bsa29I ATCGAT 1 cut(s) 42
BsaI GGTCTC 2 cut(s) 216, 262
BsaJI CCNNGG 1 cut(s) 206
Bse1I ACTGG 9 cut(s) 14, 40, 76, 102, 112, 146, 203, 239, 249
BseCI ATCGAT 1 cut(s) 42
BseDI CCNNGG 1 cut(s) 206
BseGI GGATG 3 cut(s) 174, 224, 270
BseNI ACTGG 9 cut(s) 14, 40, 76, 102, 112, 146, 203, 239, 249
BseXI GCAGC 2 cut(s) 160, 210
BshVI ATCGAT 1 cut(s) 42
BsiHKCI CYCGRG 3 cut(s) 163, 213, 259
BslFI GGGAC 1 cut(s) 261
BsmAI GTCTC 4 cut(s) 12, 110, 216, 262
BsmFI GGGAC 1 cut(s) 261
Bso31I GGTCTC 2 cut(s) 216, 262
BsoBI CYCGRG 3 cut(s) 163, 213, 259
Bsp119I TTCGAA 3 cut(s) 148, 191, 273
Bsp143I GATC 2 cut(s) 39, 101
BspDI ATCGAT 1 cut(s) 42
BspLI GGNNCC 1 cut(s) 204
BspPI GGATC 2 cut(s) 47, 109
BspT104I TTCGAA 3 cut(s) 148, 191, 273
BspTNI GGTCTC 2 cut(s) 216, 262
BsrI ACTGG 9 cut(s) 14, 40, 76, 102, 112, 146, 203, 239, 249
BssECI CCNNGG 1 cut(s) 206
BssMI GATC 2 cut(s) 39, 101
BstBI TTCGAA 3 cut(s) 148, 191, 273
BstF5I GGATG 3 cut(s) 174, 224, 270
BstKTI GATC 2 cut(s) 42, 104
BstMAI GTCTC 4 cut(s) 12, 110, 216, 262
BstMBI GATC 2 cut(s) 39, 101
BstV1I GCAGC 2 cut(s) 160, 210
Bsu15I ATCGAT 1 cut(s) 42
BsuTUI ATCGAT 1 cut(s) 42
BtsCI GGATG 3 cut(s) 174, 224, 270
ClaI ATCGAT 1 cut(s) 42
CseI GACGC 1 cut(s) 275
CviJI RGCY 7 cut(s) 29, 65, 91, 127, 135, 173, 223
CviKI_1 RGCY 7 cut(s) 29, 65, 91, 127, 135, 173, 223
DpnI GATC 2 cut(s) 41, 103
DpnII GATC 2 cut(s) 39, 101
DriI GACNNNNNGTC 1 cut(s) 254
Eam1105I GACNNNNNGTC 1 cut(s) 254
Eco31I GGTCTC 2 cut(s) 216, 262
Eco88I CYCGRG 3 cut(s) 163, 213, 259
FaqI GGGAC 1 cut(s) 261
Fnu4HI GCNGC 2 cut(s) 174, 224
FokI GGATG 3 cut(s) 181, 231, 277
Fsp4HI GCNGC 2 cut(s) 174, 224
FspBI CTAG 2 cut(s) 123, 185
GluI GCNGC 2 cut(s) 174, 224
HgaI GACGC 1 cut(s) 275
HinfI GANTC 2 cut(s) 178, 228
Hpy188I TCNGA 2 cut(s) 291, 299
Hpy188III TCNNGA 2 cut(s) 17, 115
Kzo9I GATC 2 cut(s) 39, 101
LpnPI CCDG 8 cut(s) 21, 57, 83, 93, 127, 184, 220, 230
Lsp1109I GCAGC 2 cut(s) 160, 210
MaeI CTAG 2 cut(s) 123, 185
MalI GATC 2 cut(s) 41, 103
MboI GATC 2 cut(s) 39, 101
MboII GAAGA 4 cut(s) 162, 205, 251, 287
MluCI AATT 1 cut(s) 153
MnlI CCTC 6 cut(s) 19, 55, 81, 125, 201, 247
NdeII GATC 2 cut(s) 39, 101
NlaIV GGNNCC 1 cut(s) 204
NspV TTCGAA 3 cut(s) 148, 191, 273
PfeI GAWTC 2 cut(s) 178, 228
PkrI GCNGC 2 cut(s) 175, 225
PspN4I GGNNCC 1 cut(s) 204
SatI GCNGC 2 cut(s) 174, 224
Sau3AI GATC 2 cut(s) 39, 101
SetI ASST 3 cut(s) 190, 212, 258
SfuI TTCGAA 3 cut(s) 148, 191, 273
SmlI CTYRAG 1 cut(s) 251
SmoI CTYRAG 1 cut(s) 251
Sse9I AATT 1 cut(s) 153
SspMI CTAG 2 cut(s) 123, 185
TasI AATT 1 cut(s) 153
TfiI GAWTC 2 cut(s) 178, 228
TseI GCWGC 2 cut(s) 173, 223
XspI CTAG 2 cut(s) 123, 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.